Che materia stai cercando?

Tecnologie del DNA ricombinante

Appunti scritti al pc con esercizi integrati sufficienti per superare l'esame. Vengono trattati DNA, RNA, vettori di inserzione e di sostituzione, cosmidi, fagemidi, plasmidi e vettori fagici (M13). Sono descritte le procedure di mutagenesi inserzionale, mutagenesi a cassetta, sequenziamento di Sanger e di Maxam e Gilbert.

Esame di Tecnologie del DNA ricombinante docente Prof. A. Bolchi

Anteprima

ESTRATTO DOCUMENTO

Serve clonare frammenti di DNA così grandi quando si vuole clonare del DNA genomico: un cDNA

ha dimensione media di circa 1000 b, quindi posso usare dei plasmidi, ma essendo il DNA

genomico estremamente grande quando si preparano librerie di DNA genomico si ha la necessità

di dividere il DNA genomico nel minor numero di frammenti possibile; maggiore sarà la

dimensione dei frammenti minore sarà il numero di frammenti da analizzare e meno cloni dovrò

isolare per recuperare tutta l’informazione contenuta nel DNA genomico.

Con i fagi, il grado di infezione è molto più elevato rispetto alla trasformazione con vettori

plasmidici; questi permettono inoltre il clonaggio di DNA esogeni fino anche a 20kbp.

Quando vogliamo clonare DNA genomico (di grosse dimensioni), servono quindi vettori fagici. Al

contrario se usiamo cDNA possiamo anche usare vettori plasmidici (molto usati per la costruzione

di librerie genomiche).

I plasmidi classici si dividono il cosmidi, come nel caso del fago λ (per la costruzione di librerie

genomiche), e di fagemidi, come nel caso del fago M13 (per la sintesi di DNA a singolo filamento).

Cosmide

Si tratta di un vettore ibrido di plasmidi e porzione di DNA λ, per la precisione della regione

contenente il sito cos. Questi vettori, grazie al sito cos, sono in grado di autoimpacchettarsi proprio

come i fagi lambda. La porzione plasmidica contiene il sito di policlonaggio e l'origine di

replicazione del fago. I cosmidi non ri replicano come lambda perché non contengono i geni di

replicazione e di lisi.

I cosmidi servono principalmente per il clonaggio ad altissima frequenza di infezione.

Quando il DNA cosmidico è replicato, non si formano dei circoli, ma dei concatenati simili a λ, in cui

il sito cos si ripete più volte. Se vengono aggiunte le proteine fagiche di lambda, si formano delle

particelle simili a virus (VLP) con il genoma di cosmide. Le VLP sono in grado di infettare E. coli

come fa lambda.

Dopo l'infezione la selezione va fatta secondo le modalità tipiche dei plasmidi: dopo l'infezione,

infatti, i cosmidi circolarizzano di nuovo.

Una volta estratto il DNA cosmidico, si digerisce, si aggiunge l'esogeno e, una volta formato il

concatenato, si aggiungono le proteine di λ.

Nell'esempio: frammento di 5kbp + frammento esogeno di 45kbp danno un DNA ricombinante

lungo 50kbp (< 51kbp limite), per cui la distanza tra due cos consecutivi è compatibili con

l'autoimpacchettamento.

Esistono anche vettori che permettono il clonaggio di DNA fino a 300kbp.

Nel caso di vettori cosmidici, si preferisce defosforilare l'inserto, piuttosto che il vettore, per evitare

che venga inserito più di un frammento nel ricombinante.

Esistono cosmidi con anche due siti cos, per esempio separati dal gene R cannamicina (dimensioni

7kbp): in questo caso non si forma il concatenato, ma il genoma è impacchettato comunque

perché sono presenti due cos. M13.

Fago bastoncellare, con molte proteine capsidiche, contiene una regione terminale del genoma

responsabile dell'infezione di E.coli.

Il genoma è lungo 7kbp, circolare e a singolo filamento. Contiene geni precoci e tardivi, 11 in

totale, e geni sovrapposti.

IR → è una regione intergenica, che contiene l'origine di replicazione fagica, lunga circa

500bp. M13 penetra nel batterio attraverso il pilus F' di coli.

43

Impropriamente si dice che M13 infetta solo i maschi contenenti gli episomi 13 F': questo episoma

può contenere anche marcatori di resistenza R (come quello resistente alla tetraciclina), per

consentire all'episoma di replicarsi con il batterio e non essere perso.

Quando avviene l'infezione, penetra solo il genoma e il batterio non muore: il virus interferisce con

la sua crescita, per cui, un volta piastrata la coltura, si otterranno delle placche di ridotta crescita

(al poso di quelle di lisi), dove il batterio è stato infettato con successo. Il batterio è come se fosse

quindi malato.

→ Replicazione di M13: Il filamento singolo iniettato nel batterio è indicato come(+). In

poco tempo, viene replicato e si forma il filamento doppio RF (replicative form), che viene

duplicato a formare tante copie. Attivati i geni tardivi la replicazione produce solo la forma(+).

segue l'incapsidazione e la fuoriuscita attraverso il pilus. Anche in questi fagi è possibile sfruttare

l'α–complementazione. Teoricamente non ci sarebbe limite alla lunghezza del DNA clonale, ma

superate le 5–7kbp questo tipo di clonaggio smette di essere efficiente.

Il fago M13 è normalmente usato per avere dei cloni a singolo filamento, sopratutto nel caso del

sequenziamento di Sanger (a 37°C). Adesso il sequenziamento si fa ad alte temperature, quindi il

due filamenti si separano spontaneamente e non è più necessario usare uno stampo a singolo

filamento.

Oggi il fago M13 si usa per la mutagenesi sitospecifica del DNA. Di solito si fa per studiare l'attività

di una proteina: si modifica un codone che codifica per un aminoacido essenziale per la catalisi per

capire di preciso la sua funzione. Si usa un primer mutagenizzante (con forcine) che dia

misappaiamenti. Di solito si ricorre a plasmidi o fagi λ, per poi trasferire il genoma in M13, tramite

una procedura detta di subclonaggio.

→ Subclonaggio: Serve perché DNA ligasi ed enzimi di restrizione non funzionano sui singoli

filamenti. Si usano quindi dei vettori a doppio filamento nella forma RF, che vengono clonati

all'interno di un batterio. Il DNA utilizzato è necessario che si trovi quindi nella sua forma

replicativa RF, unica forma utilizzabile in vitro per la manipolazione con enzimi di restrizione e di

ligazione. Le molecole RF si replicano con meccanismo rolling-circle per produrre DNA lineare a

singolo filamento; soltanto il DNA a singolo filamento è utilizzabile dal virus per

l'impacchettamento. A questo punto la procedura è identica al recupero di un plasmide: non si può

sfruttare il packaging automatico perché è a doppio filamento e quindi si procede alla

trasformazione. La selezione poi torna ad assomigliare a quella con λ, con la formazione di placche

di ridotta crescita.

La selezione dei ricombinanti può essere fatta con α–complementazione β-gal X-gal, ma siccome

non si può fare l'analisi di restrizione sui fagi bisogna per forza produrre le forme replicative RF.

Il clone ricombinante può dare il DNA a singolo filamento tramite purificazione dei fagi con PEG,

proteinasi K e infine alcol e sale. Di solito, comunque, la particella fagica è recuperata solo se serve

il ssDNA.

Per stabilire quale dei due filamenti desiderati deve essere inserito nel virione, è sufficiente

osservare la direzione dell'origine di replicazione fagica.

(+) → contiene l'origine che fa partire la replicazione in senso orario.

(-) → contiene ori in senso antiorario.

Se si procede con un clonaggio non direzionato, bisogna fare l'analisi dei ricombinanti per capire se

ssDNA contiene la sequenza senso o antisenso. 44

Se volgiamo tutte e due le forme di ricombinanti con un clonaggio direzionato, è sufficiente

inserire entrambi gli ssDNA (+ e -). Fagemidi:

Si tratta di plasmidi con origini di replicazione di M13 (o F1), che contengono anche MCS e l'origine

del plasmide. Servono principalmente per produrre ssDNA all'occorrenza, senza dover ricorrere al

subclonaggio. Tutti i plasmidi di laboratorio oggi sono fagemidi, in modo da poter sempre produrre

un DNA a singolo filamento senza dover ricorrere a procedure ulteriori, che rubano tempo e

denaro.

Come si attiva oriM13?

Prima di tutto ogni fagemide contiene solo uno dei due filamenti di M13, + oppure -, non entrambi.

Per esempio: pMBL8 (+) e pMBL8 (-), sono identici eccetto per l'orientamento della porzione

derivante da M13. A seconda di quale dei due fagemidi uso ottengo una sequenza senso e una non

senso. Una volta clonato il DNA, ssDNA si ottiene infettando il batterio con M13 wt, detto fago

helper, in modo che l'ori sul fagemide venga attivata. Ovviamente il batterio deve avere un pilus

coniugativo per poter essere infettato.

Si aggiungono quindi le proteine capsidiche di M13 in modo che avvenga l'autoimpacchettamento.

Come prodotti finali ottengo fagi con DNA da fagemide e DNA di M13 dell'helper. C'è la possibilità

di escludere direttamente il fago helper dai prodotti.

λZAP:

Si tratta di fagemidi in cui è stata inserito l'intero genoma di λ. Permette di evitare il subclonaggio e

consente di inserire DNA da 0 a 106 bp. Si possono produrre librerie genomiche o produrre cDNA.

Una parte della regione stuffer di lambda è stata sostituita con la sequenza di un plasmide

(pBluscript), che serve poi all'analisi dei trasformati e dei ricombinanti.

In questa regione c'è una regione fagemidica di excisione, che permette di clonare solo il fagemide.

Il genoma di lambda è stato aggiunto perché ha un'alta efficienza di clonaggio, producendo tanti

cloni in poco tempo. Posso scegliere con questo metodo se produrre librerie a placche (con virus)

oppure a colonie (con fagemide).

Procedura:

• Se E. coli non è già competente, si infetta con l'episoma F';

• Infettare E. coli F’ con λZAP ricombinante;

• Superinfettare con il fago helper M13 o f1. Crescere 4h a 37°C;

• Recuperare il surnatante e scaldarlo a 70°C per 20 minuti. E. coli e λ muoiono, mentre le

particelle M13 (o f1) sono resistenti;

• Utilizzare questo surnatante per infettare E. coli F’ e selezionare su Ampicillina →

sopravvive solo il batterio con il fagemide che ha il marcatore di resistenza.

• Il tutto funziona perché il fago helper oltre a replicare sé stesso, replica anche la regione su

λZAP, che corrisponde al fagemide.

La lisi produce:

• λZAP;

• fago hepler M13;

• pseudofagi con genoma fagemidico.

ΛZAP è un plasmide di inserzione quindi consente di selezionare con α–complementazione; è

equipaggiato con MCS e con una sequenza plasmidica che può subire excisione in vivo per essere

convertita in un vettore. 45

Clonaggio di organismi diversi da E. coli.

Requisiti per il clonaggio di geni in un nuovo ospite:

1. Possibilità di introdurre il DNA nel potenziale organismo ricevente (possibilità di

trasformazione).

2. Il DNA introdotto deve poter essere mantenuto all’interno del nuovo organismo:

• come replicone indipendente (plasmide)

• integrandosi nel cromosoma endogeno;

• integrandosi in un plasmide preesistente.

In tutti questi casi, il DNA trasformante deve potersi propagare in un batterio di amplificazione

(E.coli) in modo da poterlo manipolare e produrne una quantità sufficiente alla trasformazione.

3. Se il gene trasferito codifica per una proteina, esso deve potersi esprimere nel nuovo

ospite. Vettori navetta (shuttle)

Caratteristica propria dei vettori shuttle è la capacità di essere propagato nel batterio E.coli e

trasferito in un nuovo ospite (altro batterio o organismo eucariotico). Qui il plasmide può

propagarsi o integrarsi nel genoma del nuovo ospite.

Sono vettori che contengono (di solito) plasmidi di funghi/lieviti, MCS, origine di replicazione

batterica e marcatori R di batteri. Costruzione di librerie

Lo scopo di una libreria genomica è di poter identificare un particolare gene anche quando non si

conosce la sua esatta sequenza o ubicazione all'interno del genoma; generando una genoteca di

cloni (raccolta di cloni indipendenti utilizzata per l'analisi funzionale di frammenti genomici) è facile

poi selezionare il gene d'interesse.

Il primo passo è digerire l'intero genoma in frammenti che poi devono essere clonati

singolarmente e contemporaneamente; questi cloni vengono conservati in un unico pool e

conservati a -80°C. La conservazione è essenziale perché spesso non si è subito in grado di eseguire

uno screening della libreria.

Una volta pronti, si preleva un'aliquota della libreria allo scopo di isolare il singolo clone

d'interesse. Si preleva un'aliquota perché le procedure di analisi tendono a degradare gran parte

del materiale e a distruggere le librerie quindi spesso possono essere eseguite solamente una

volta. Il DNA è sottoposto a ligasi perché è necessario che i frammenti siano circolarizzati per

essere inseriti nel batterio e successivamente sottoposti a trasformazione.

VETTORI

Scelta del vettore:

• Il vettore deve essere adeguato agli DNA esogeno da inserire; dipende dalla grandezza

dell'esogeno da inserire.

• Efficienza di trasferimento in batterio più alta possibile per ottenere librerie ad elevata

complessità

• Lo screening della libreria deve essere facile, esaustivo (assenza di perdite di cloni positivi) e

inequivocabile (assenza di falsi positivi)

Una volta inserita la ligazione è necessario inserire nella libreria tutti i possibili RNA estratti dalla

cellula.

1. libreria genomica: cloni contenenti frammenti del DNA estratto da un microrganismo. Una volta

estratto DNA genomico questo ha dimensioni enormi; va quindi frammentato producendo una

46

miriade di frammenti che vanno inseriti nel vettore per formare una libreria il più completa

possibile. Per la libreria genomica sono preferibili lambda di sostituzione (sotto forma di placche) o

i cosmidi (simili a virus). Vengono poi piastrati su antibiotico per l'analisi dei ricombinanti.

Si cerca di realizzare una libreria in cui la quantità di ricombinanti sia il meno possibile.

Una libreria genomica è quindi una collezione di cloni contenenti DNA genomico estratto da un

organismo; è necessario un vettore che consenta il contenimento di frammenti grandi.

L'importante è avere una buona quantità di partenza, il primo passo è frammentare il genoma, i

frammenti vanno poi inseriti nella libreria.

Questi frammenti vengono inseriti in vitro tramite infezione ovvero il campione viene sottoposto a

manipolazione in vitro e selezione che può essere fatta con antibiotico ottenendo colonie oppure

ottenendo placche. È essenziale controllare l'efficienza di trasferimento: i non ricombinanti devono

essere pochissimi; per i tessuti con parete bisogna utilizzare azoto liquido.

Dal momento che nella libreria genomica si utilizzano i fagi, si parla di propagazione di frammenti

di DNA genomico da clonare che viene inserito nel capside grazie alla presenza di due sequenze

cos, iniettato nel batterio e integrato nel suo DNA per proseguire con il cito litico. SI possono

seguire diverse procedure di propagazione:

• 1) Digestione completa con un enzima di restrizione: A seconda del numero di basi di cui è

composto il sito di taglio, otteniamo un certo numero di frammenti (teorico) e quindi

abbiamo bisogno di un diverso numero di cloni per ottenere una libreria soddisfacente.

9

Genoma umano = 2.8 10 bp

-Se l’enzima riconosce un sito di 6 basi (Es. EcoRI) taglierà mediamente ogni 4096 basi; una libreria

9 5

genomica umana deve quindi contenere almeno n = 2.8 10 / 4˙096 = 6.8 10 cloni.

-Se l’enzima riconosce un sito di 8 basi (Es. NotI) taglierà mediamente ogni 65˙536 basi; una libreria

9 4

genomica umana deve quindi contenere almeno n = 2.8 10 / 65˙536 = 4.7 10 cloni.

Svantaggi

-La digestione non è completamente casuale e la sequenza che interessa potrebbe essere

localizzata in un frammento di DNA genomico troppo lungo o troppo corto per entrare nel vettore

usato. È quindi preferibile non usare un enzima di taglio.

-Essendo tutti cloni indipendenti, non è possibile ricostruire per intero la sequenza del genoma

(non c’è sovrapposizione tra i cloni). Non si sa esattamente in che cromosoma e in che regione era

quell’inserto. La presenza di cloni sovraposti è essenziale anche per il sequenziamento del

frammento.

• 2) Frammentazione meccanica o per sonicazione: (“mechanical shearing”) E’ una

frammentazione veramente casuale, ma il DNA così ottenuto viene sottoposto a diversi

passaggi prima del clonaggio, riducendo l’efficienza di clonazione (a volte insufficiente per

ottenere librerie rappresentative dell’intero genoma).

I frammenti vanno convertiti in DNA con estremità compatibili con il vettore, e questo richiede

molti passaggi. Si può usare la sonicazione (ultrasuoni) o far passare il DNA sotto aghi sottili.

L’inconveniente è che la rottura del DNA non avviene simmetrica tra i due filamenti quindi non si

hanno estremità piatte, non si ha facile clonaggio del DNA. Bisogna modificare le estremità così da

avere una clonazione semplice.

L’elettroforesi di questi frammenti sarà a DNA strisciato; per selezionare solo una parte del DNA si

taglia una parte di gel alle misure desiderate e poi si purifica il DNA. Per modificare le estremità di

questo DNA di dimensioni desiderate si possono usare degli adaptor o i linker (questo fa ottenere

estremità piatte, ma, si rischia di tagliare dei siti quindi si metila il DNA secondo EcoR1 e poi, una

47

volta completato il processo) si fa una restrizione nei siti desiderati. Lo svantaggio è che a ogni

reazione che si aggiunge si perde materiale causando una diminuzione della complessità della

libreria.

• 3) Digestione parziale con un enzima di restrizione che taglia frequentemente (sito di

riconoscimento di 4 basi)

a. Si digerisce il DNA genomico parzialmente utilizzando le condizioni che forniscono il maggior

numero di molecole di dimensioni nel “range” (Es. 20-25kb oppure 35-45kb) clonabile nel vettore

scelto (Es. fago λ oppure cosmide).

b. I frammenti clonabili vengono purificati mediante elettroforesi su gel di agarosio o

centrifugazione in gradiente di densità di saccarosio e vengono clonati nel vettore opportuno.

Più tempo si lascia agire il set di enzimi più la strisciata sul gel apparirà in basso.

Nel caso della costruzione di librerie genomiche la defosforilazione degli inserti impedisce di

clonare due frammenti genomici nello stesso vettore. Se questo succedesse, si avrebbero delle

mappature genomiche scorrette.

Complessità di una libreria=numero di cloni indipendenti presenti nella libreria.

La determinazione della dimensione o complessità della libreria avviene mediante conta delle

colonie/placche: ogni colonia corrisponde a un clone indipendente, cioè deriva da un evento di

clonaggio indipendente.

Ogni piastra da 15 cm di diametro può contenere 20000-50000 colonie o placche sufficientemente

5

separate. Se si vuole preparare una libreria di 8*10 colonie si devono ottenere dopo clonaggio ad

5

es. 20 piastre da 40000 colonie ciascuna 8*10 colonie / 40000 colonie per piastra = 20 piastre.

Il numero (N) di molecole di DNA

ricombinanti indipendenti deve

raggiungere il 99% di probabilità di aver

clonato una particolare sequenza, sia in un

vettore lambda che in un cosmide.

A seconda della dimensione del genoma

iniziale e del tipo di vettore utilizzato, le

librerie genomiche hanno una complessità

da centinaia a milioni di cloni.

48

Preparazione di libreria a cDNA

Ogni libreria dipende dall’RNA iniziale che cerco quindi varia dal tessuto che analizzo e

dall’organismo analizzato. È una sorta di istantanea del trascrittoma del tessuto che stiamo

analizzando. Si può arrivare anche a 40 mila tipi di mRNA diversi, per questo bisogna preparare

6

delle librerie anche con 10 cloni. Per permettere l’inserzione è necessario inserire del cDNA a

doppio filamento così che sia già traducibile; si ha prima la sintesi di un ibrido RNA-DNA e poi della

molecola a doppio filamento. Per questa procedura si utilizza una trascrittasi inversa (da RNA

sintetizzano DNA).

L’informazione contenuta in un mRNA (cDNA) rappresenta la parte trascritta del genoma, che, a

seconda dell’organismo, può rappresentare anche soltanto l’1% del genoma (es. uomo).

Il sequenziamento di una libreria a cDNA può aiutarci a comprendere come è organizzata la

sequenza del gene nel DNA genomico di un organismo di interesse.

La funzione di un gene può essere più facilmente studiata se esso viene espresso in un organismo

semplice come un batterio. Poiché il batterio non è in grado di fare splicing si preferisce utilizzare

per l’espressione la sequenza codificante, privata degli introni (cioè il cDNA).

Preparazione del cDNA

• -In un organismo pluricellulare il contenuto di mRNA può variare da cellula a cellula, da

tessuto a tessuto

• -L’mRNA non può essere clonato, occorre prima convertirlo in DNA a doppio filamento

contenente la medesima sequenza (cDNA).

• Il cDNA può quindi essere inserito in un vettore opportuno (plasmide o fago λ).

La sintesi del cDNA a doppio filamento avviene in due fasi:

1. Sintesi del primo filamento per retrotrascrizione

La sintesi è semplice. Si utilizza la DNA polimerasi RNA dipendente (trascrittasi inversa) in

presenza del templato di mRNA (o RNA totale), un primer che si appaia a tutte le molecole di

mRNA e i dNTP.

Esistono due trascrittasi inverse che possono essere utilizzate:

- Avian reverse transcriptase (AMV): Temp. ottimale 42°C

-Murine reverse transcriptase (MMLV): Temp. ottimale 37°C

2. Sintesi del secondo filamento

La reazione viene eseguita con una DNA polimerasi DNA dipendente, ma risulta molto più

complessa della prima sintesi perché non è facile trovare un primer comune appaiabile a tutto il

cDNA a singolo filamento. Preparazione dell’mRNA

La costruzione di librerie eucariotiche inizia con la sintesi del primo filamento e usa come templato

l’RNA (o l’mRNA). L’mRNA è soltanto una piccola frazione (2-5%) dell’RNA totale che è

prevalentemente costituito da RNA ribosomiale (rRNA) non adenilato. L’mRNA eucariotico è

poliadenilato al suo 3’; questa caratteristica viene sfruttata per isolare l’mRNA eucariotico dall’RNA

totale, sfruttando oligonucleotidi poli(dT).

La banda sul fondo, spesso presente nelle elettroforesi di questi mRNA, corrisponde ai tRNA.

Purificazione dell’mRNA

Quando retrotrascriviamo assumiamo che ci siano talmente tanti mRNA che il tasso di errore della

RT (retro trascrittasi) sia trascurabile. Il primer oligodT deve legarsi alla coda poliA del messaggero

49

e deve essere aggiunto in forte eccesso rispetto al templato. Esistono anche OligodT ancorati, che

hanno all'estremità 3' una base diversa da T che si appai in modo specifico all'estremità 5'

dell'mRNA appena prima del poliA.

Caratteristiche dell’mRNA eucariotico

Una cellula di mammifero tipica contiene tra 10˙000 e 30˙000 differenti mRNA, non tutti

equamente rappresentati. Cellule appartenenti a tessuti differenti possono contenere mRNA

differenti e/o differentemente rappresentati. La loro abbondanza dipende dall’efficienza di

trascrizione del gene corrispondente e dalla stabilità dell’mRNA.

Una cellula eucariotica ci sono circa 200000 mRNA per cellula con circa 12000 geni poco o

pochissimo abbondanti (15-1 copie/cellula) che determinano la complessità finale della libreria.

Esercizio: quanti cloni devo produrre ed analizzare per avere la certezza di isolare qualnque cDNA?

Ovvero quale dev'essere la complessità della mia libreria?

12000 differenti mRNA sono poco abbondanti (10 copie per cellula); il numero minimo n di cloni di

cDNA necessario per rappresentare completamente l'mRNA di questa classe poco abbondante

(perché sia almeno un clone per ogni specie di mRNA) sarà:

200000 (numero totale medio di molecole/cellula) / 10 = 20000.

Il numero N di ricombinanti da isolare e analizzare, per avere una certa probabilità P che il clone

desiderato sia rappresentato nella libreria è dato dalla formula vista per le librerie genomiche:

Molti mRNA sono presenti nella cellula ad un livello più basso di quello considerato (anche

solamente 1 molecola per cellula).

Per isolare il clone desiderato è quindi necessario costruire librerie a cDNA costituite da diversi

milioni di cloni indipendenti e vagliare diversi milioni di cloni di cDNA.

La sintesi del primo filamento di una DNA polimerasi con trascrittasi inversa dNTP e un templato a

singolo filamento con un primer che fornisca l’OH libero. Solitamente si usa l’oligo dT ovvero un

primer costituito da poly T. Bisogna stare attenti a non aggiungere le RNasi o comunque ad

aggiungere le RNasine ovvero sostanze che bloccano l’azione delle Rnasi.

Se si vuole trasformare in cDNA un mRNA batterico (che non ha quindi il poliA), solitamente si usa

un primer generato randomicamente di esameri. Questi primer però possono ipoteticamente

appaiarsi ovunque sul DNA genomico e quindi potrebbero appaiarsi troppo vicino al 5', perdendo

gran parte dell'informazione a questa estremità. Questo oligonucleotide può contenere al 5' una

sequenza non complementare, che può però essere scelta da noi: possiamo quindi inserire un sito

di restrizione. Il cDNA a singolo filamento non può essere attaccato da enzimi di restrizione. Per

produrre una molecola a doppio filamento bisogna estendere con una polimerasi classica, per

esempio una Klenow. Richiede ancora un primer.

Nella sintesi del secondo filamento si deve tenere in considerazione il fatto di creare estremità

compatibili al clonaggio in un vettore.

Per una purificazione corretta è necessaria una matrice solida derivatizzata con oligo poli(dT);

un'alta concentrazione di sale che permetta il legame dell’mRNA all’oligo poli(dT); l'aggiunta di una

soluzione ad alta concentrazione di sale che permetta il legame dell’mRNA all’oligo poli(dT) ed il

rilascio del poliA- (rRNA e tRNA). L'aggiunta finale di una soluzione a bassa concentrazione di sale

permette l'eluizione dell’mRNA.

Per la sintesi del primo filamento è necessario un primer:

a) Oligo(dT) di 12-18 nucleotidi che si lega al poli(A) al 3’ delle molecole di mRNA. Il primer viene

aggiunto in forte eccesso rispetto all’mRNA. 50

b) Un Oligo(dT) “ancorato” che funziona solo se si appaia all’inizio della coda poliA

5’ TTTTTTTTTTTTTTTTTTTTTTV 3’ Con V = A, C, G → V’= base complementare a V

V TTTTTTTTTTTT-5’ V’AAAAAAAAAAAAAA(A)n-3’ mRNA

Vantaggi: l’uso di un oligo(dT) come primer permette di poter usare come templato l’RNA totale.

Sarà il primer a selezionare l’mRNA; il 3’ dell’mRNA è sicuramente copiato in cDNA.

Svantaggi: è possibile che il 5’ dell’mRNA non sia copiato il cDNA.

c) “Random priming”.

Ovvero un oligonucleotide degenerato (casuale) che può appaiarsi in qualunque posizione

dell’RNA; è una miscela di oligonucleotidi.

Random Primer esamero: 5’ NNNNNN 3’ dove N: A, T, C o G

Vantaggi: è più probabile che il 5’ dell’mRNA sia copiato in cDNA

Svantaggi: il 3’ del cDNA è scarsamente rappresentato nella libreria; è indispensabile usare come

templato un mRNA purificato dall’RNA totale, per evitare che la maggior parte della complessità

della libreria sia dovuta a RNA non messaggeri.

NB all’estremità 5’ del primer (sia oligo(dT) che Oligo(dT) “ancorato”) può già essere presente una

sequenza utile per il clonaggio in un vettore.

Sintesi del secondo filamento

La sintesi del secondo filamento viene ottenuta con una DNA polimerasi DNA dipendente e

richiede ancora un primer. Nella sintesi del secondo filamento si deve tenere in considerazione il

fatto di creare estremità compatibili al clonaggio in un vettore DNA (cDNA) mRNA.

Questa sintesi può avvenire in tre modi differenti:

→ self-priming.

Siccome non esiste un primer universale, di solito si sfrutta il self-priming. Una buona percentuale

delle terminazioni 3’ dei cDNA a singolo filamento sono capaci di formare delle strutture a forcina,

che possono essere usati da primer per la sintesi del secondo filamento da parte della frammento

Klenow della DNA polimerasi I di E. coli o da parte della trascrittasi inversa. Il “loop” che si crea al

5’ del cDNAds può essere poi eliminato mediante digestione blanda con la nucleasi S1. In questo

modo però si perde un po' di materiale al 5'. Infatti questo sistema è stato per lo più abbandonato.

→ sintesi per sostituzione (replacement synthesis)

Il prodotto di sintesi del primo filamento (l’ibrido cDNA:RNA) viene usato come templato per una

reazione di “nick-translation”. L’RNAsi H produce nell’ RNA dei “nick” e dei “gap” creando una serie

di primer a RNA che possono essere usati dalla DNA polimerasi I di E. coli per sintetizzare il

secondo filamento del cDNA. L’aggiunta della Ligasi del fago T4 permette poi di unire i vari

frammenti sintetizzati.

Vantaggi: E’ più efficiente della self-priming; Elimina l’uso della Nucleasi S1.

Svantaggi: Può rimanere la struttura 5’ cap delI’mRNA e impedire la clonazione successiva;

non viene sintetizzata l’estremità 5’ del secondo filamento del cDNA e quindi si perde il cDNA

intero (“full length”).

→ sintesi mediante code omopolimeriche.

Al singolo filamento di cDNA può essere attaccata una coda omopolimerica (es. oligo(dC))

mediante la transferasi terminale. Questa coda può essere ibridata con un oligo(dG) e servire da

primer per la sintesi del secondo filamento. 51

In questo modo non si perde materiale genetico. Il problema è che tutti i cloni presentano al 5’ una

coda poli(dG):poli(dC), che disturba nel caso si voglia creare una libreria di espressione: la

polimerasi usata per il sequenziamento su queste sequenze rischia uno slittamento della base con

il cambiamento nel frame shift e quindi nella sequenza della proteina corrispondente. La sequenza

a valle è illeggibile.

dscDNA = double strand ciclic DNA.

Nel cDNA non ci sono i promotori dei geni; ma essendo una copia dell’mRNA non contiene

promotori; gli unici sono quelli batterici che inserisce il biologo molecolare.

Vettori per la clonazione del cDNA

a) Plasmidi: Sono i vettori preferiti per la clonazione del cDNA, ma data la bassa efficienza di

trasformazione permettono di ottenere librerie a cDNA di ridotte dimensioni. Vanno bene nel caso

in cui si ha a disposizione molto RNA di partenza (diversi μg). Se la clonazione è direzionale, è

possibile costruire una libreria a cDNA di espressione (che sarà sempre di fusione).

b) Vettori λ: Permettono di realizzare librerie a cDNA di notevoli dimensioni, anche da pochissimo

mRNA, grazie alla elevata efficienza di packaging e successiva infezione.

Per appiattire le estremità protrudenti 3' usiamo la pol Pfn. Il passo successivo è la selezione

tramite piastratura. I vettori lambda sono quelli di inserzione, oppure quelli sia di inserzione sia di

espressione.

I vettori di espressione sia lambda sia fagemidi devono avere la possibilità di esprimere le

corrispondenti proteine della libreria a cDNA, anche se questo DNA deriva da organismi superiori.

Esistono vettori come λZAP, che consentono di convertire una libreria in λ o una libreria in

fagemidi.

L'inserzione direzionata è essenziale per l'espressione. Inoltre il promotore deve essere batterico.

Per l'espressione non si clona mai DNA genomico, perché i batteri non sono in grado di processare

l'mRNA tramite splicing. Il cDNA deve contenere un RBS batterico con ATG e Shine–Dalgarno.

Dal momento che la sequenza di Shine-Delgarno è presente seolamente nei batteri, è necessario

aggiungerla al sito di legame per i ribosomi (RBS) tramite adaptor. Lo stesso vale per ATG.

Ogni batterio, ogni clone ha un trascritto corrispondente al suo mRNA, ecco perché si inseriscono

cDNA, perché sono già processati. 52

L'ATG è inserito a circa 7/8 bp dalla sequenza di Shine-Delgarno; si aggiunge un adaptor

corrispondente a qualche base di un gene batterico con ATG. Si costruisce quindi una sequenza di

fusione (libreria di espressione di fusione) la cui proteina ha come primo amminoacido all'N-

terminale la formil-Metionina e qualche amminoacido betterico.

Può capitare che l'inserimento di queste sequenze sposti la cornice di lettura producendo una

proteina tronca o non funzionale. Solo una frazione (1/3) dei ricombinanti daranno espressione.

Preparazione di una libreria di geni artificiali a sequenza random o semi-random

Si parte da sequenze artificiali a singolo filamento e le si rende a doppio filamento; a questo segue

la preparazione del vettore (plasmidi o fagi M13), la manipolazione in vitro, l'infezione in cellule

batteriche. Queste verranno poi piastrate con terreno specifico per l'analisi dei ricombinanti.

DNA artificiale:

Si usano i sintetizzatori di DNA (si possono sintetizzare anche RNA e proteine (anche se solo

oligopeptidi)). Normalmente il DNA prodotto non supera le 80–90 basi. La sequenza è sempre

inserta per convenzione dal 5' al 3'. Se si vuole ottenere una molecola ds, si fanno due sintesi, per

cui un filamento sarà opposto all'altro.

Gli oligonucleotidi sono usati come primer per sequenziamento, PCR, mutagenesi, sintesi di cDNA.

Sintesi in fase solida di oligonucleotidi

Questa reazione richiede la totale assenza di H O (in solventi organici, anidridi e gas inerti) e di

2

ossigeno perché è una reazione nucleofila; la macchina viene quindi costantemente irrorata di

argon. L’acqua non può essere presente (anche l’ossigeno non deve esserci) perché rischiano di

andare ad interagire con l’atomo di P.

La sintesi avviene su fase solida dal 3’ al 5’ (in senso opposto rispetto a quella originale) perciò il 3'-

OH è ancorato al supporto. Il 5'-OH (fosfito 3+) non è immediatamente reattivo, ma p protetto da

un gruppo chimico quale DMTO: il DMTO è eliminato con solvente organico non appena viene

rilasciato il secondo nucleotide.

Ogni estremità potenzialmente reattivo delle molecole in gioco è protetta da gruppi chimici per

evitare reazioni nucleofile secondarie indesiderate.

Se non espressamente richiesto, gli oligonucleotidi sono forniti defosforilati al 5’.

Per tutti i nucleotidi:

• Protezione del 5’ OH con DMTO (=dimetossitritile). Viene eliminato prima dell’aggiunta della

base entrante

• Protezione del OH del fosfito con gruppo metilico e del gruppo biisopropiulammino

• Protezione dei gruppi reattivi sulle basi. Vengono eliminati solo alla fine della sintesi.

Il secondo nucleotide è fornito in eccesso: quello che non lega è lavato via con solvente inorganico.

Alla fine della reazione vengono staccati tutti i gruppi protettori per rendere la molecola finale

biologicamente utile. La colonna della macchina sputa l'oligonucleotide in una soluzione basica;

questa può produrre fino a 4 oligonucleotidi contemporaneamente ottenendo così miscele

randomiche.

Il motivo per cui si arriva ad un massimo di circa 80 basi di lunghezza è che spesso si verificano

aborti di sintesi (perdita di basi).

Se vogliamo produrre un gene di mille bp, basta sintetizzarlo a pezzi → La lunghezza massima di un

oligonucleotide ottenibile con un sintetizzatore è di 80-100 basi. Data una sequenza proteica è

possibile realizzare un gene sintetico corrispondente unendo una serie di primer differenti.

53

Questi primer vengono ideati in base del codice genetico e tenendo presente il codon usage

dell’organismo in cui si vuole esprimere il gene sintetico. Facciamo in modo che si formino sticky

ends precise in modo che si debba solo aggiungere la ligasi.

La direzione di sintesi artificiale è 3'→5'

Sintesi di geni artificiali

La lunghezza massima di un oligonucleotide ottenibile con un sintetizzatore è di 80-100 basi perché

ci sono molti aborti di sintesi (nell’attacco successivo è possibile perdere delle basi). Attraverso

delle procedure di purificazione si possono distinguere quelle con la sequenza corretta. Data una

sequenza proteica è possibile realizzare un gene sintetico corrispondente unendo una serie di

primer differenti. Questi primer vengono ideati in base del codice genetico e tenendo presente il

codon usage dell’organismo in cui si vuole esprimere il gene sintetico. Si fa in modo che

dall’appaiamento si producano delle estremità protrudenti che possano essere unite da una ligasi.

Mutagenesi sito-specifica per sostituzione di cassetta.

È la prima che il biologo molecolare guarda se è possibile applicare

Può essere utilizzata quando attorno al sito da mutare sono presenti due siti di restrizione unici, e

distanti tra loro di non più di 50-60 basi.

Il DNA plasmidico viene tagliato con gli enzimi di restrizione e il piccolo frammento di DNA

interposto viene rimpiazzato da un frammento di DNA mutante (cassetta) composto da due

oligonucleotidi sintetici complementari, formanti per appaiamento estremità coesive, utili per il

clonaggio. SI possono quindi sostituire porzioni di codoni. Questa tecnica è usata per modificare gli

MCS dei vettori (che sono siti unici e non troppo distanti da loro).

Esercizio: Praticando un taglio con BamHI ed ecoRI

si attua una delezione di Sac1 e Kpn1 e

l'inserzione sostitutiva di EcoRV che va a

sostituirli. Gli altri siti non devono essere

modificati. Si può fare mediante

mutagenesi a cassetta: si taglia il sito e si

toglie. Si digerisce con EcoR1 e BamH1.

In questo modo però si perde SmaI che

può essere rinserito con mutagenesi a

cassetta.

Si crea un adaptor contenente le

porzioni dei siti di restrizione taglieti alle

estremità, la sequenza del sito da

inserire e quella del sito tolto durante la

precedente delezione. Purifico

frammento più grande corrispondente al

vettore.

54

Libreria di geni artificiali a sequenza random o semi-random:

Una cassetta mutante può anche essere composta di oligonucleotidi degenerati:

Sequenza random (N° triplette*3 +1). Tutte le triplette sono casuali.

Sequenza semi-random (N° triplette*3). Solo alcune triplette sono casuali.

Controllo della qualità di una libreria.

1) Complessità della libreria → Per determinare il numero di cloni indipendenti si fa la conta.

La complessità può essere superiore o inferiore a quella teorizzata prima di iniziare ed è il

numero dei cloni di batteri prodotti a seguito della trasformazione o dell'infezione. Se la

percentuale di vettori vuoti è molto bassa, coincide con il numero di cloni indipendenti.

Librerie di buona qualità contengono dalle centinaia di migliaia a milioni di cloni; una

complessità alta è garantita da un’altra efficienza di trasferimento del DNA in batterio e da

una buona procedura di preparazione e manipolazione del DNA in vitro. Se la complessità è

troppo bassa, bisogna necessariamente ripetere tutto da capo, prestando maggiore

attenzione ai punti di controllo per individuare eventuali errori.

2) Percentuale dei vettori ricombinanti → Viene valutata immediatamente quando il vettore

lo permette (ad esempio per lo screening bianco/blu -> % di colonie bianche sul totale delle

colonie). Altrimenti si può fare un’analisi di qualche clone, tramite restrizione o PCR per

valutare la % di ricombinanti. Librerie di buona qualità hanno una % di ricombinanti vicino

al 100%. Se molti cloni corrispondono al vettore senza inserto, la complessità della libreria

viene sovrastimata e può essere necessario vagliare molti più cloni per trovare quello di

interesse.

3) Dimensione degli inserti → Una buona libreria ha inserti di taglia eterogenea, perché

provengono da DNA diversi. Solitamente si vagliano 50-100 cloni per libreria per PCR o per

digestione; la dimensione media deve essere vicina a quella prevista in base alle

caratteristiche del clonaggio scelte. All'inizio del clonaggio, si cerca di eliminare i frammenti

più piccoli prodotti dalla retro-trascrittasi, perché questi inserti sono i primi a fare ligazione,

precludendo l'inserzione dei frammenti di dimensioni maggiori, rischiando di ottenere

ricombinanti solo con frammenti piccoli. Il range ottimale per l'inserto a cDNA è di solito sui

1200bp. È importante poi ottenere con l'analisi elettroforetica dopo PCR, che l'amplicone

sia di taglia unica. Amplificazione della libreria:

Precede lo screening (o vaglio) per individuare i cloni di DNA d'interesse: qualunque clone può

sopravvivere al massimo da uno a due mesi. Poiché non si è sempre pronti ad eseguire lo screening

immediatamente dopo la preparazione della libreria, è necessario prolungare il periodo di

sopravvivenza della mia banca. Non si può congelare direttamente le piastre a – 80°C.

Durante la piastratura dei batteri trasformati (o infettati) si ha immediatamente un’amplificazione

della libreria, dal momento che ogni singolo batterio trasformato (o infettato) da origine ad una

colonia contenente circa un milione di batteri (o ad una placca che libera migliaia di fagi). È

importante poter avere colonie o placche abbastanza distanziate in modo che non si

sovrappongano tra loro (50.000 su piastre da 15cm di diametro). Il passo successivo è raccogliere i

cloni, in un mix o pool della libreria, che viene trasferito in terreno liquido, a cui vengono aggiunte

sostanze crioprotettive (glicerolo):

Per calcolare la complessità teorica della libreria si parte quindi dal cfu (colony forming unit) o di

pfu (plaque forming unit) contate a partire da una piccola frazione della libreria (1-2 piastre).

Raccolta delle colonie:

- Si aggiunge di pochi ml di terreno liquido su ogni piastra.

55

- Si raschiano via le colonie dal terreno solido.

- Si riunisce il tutto in un unico tubo.

Una volta preparato il pool, bisogna determinarne il titolo (n di cloni/ unità di V) ovvero la

concentrazione; solo una volta fatto questo si può procedere al congelamento. 5

La complessità è sempre quella ricavata per conta e restituisce la quantità totale di batteri: (8*10

6

colonie (n° colonie)*10 batteri/colonia). 10 7

Il titolo (concentrazione) invece varia: per esempio, potrebbe essere 1.6 10 batteri/ml= 1.6*10

8

batteri/μl oppure si misura l’OD (1OD= 8*10 batteri/ml). Per riottenere in una piastratura

successiva di nuovo di 800 mila colonie si prelevano frazioni adeguate dal terreno di pool.

Quindi, su una libreria amplificata è necessario fare prima l'analisi (screening) e poi trattarla per la

corretta protezione (aggiunta di un crioprotettore come DMSO o glicerolo, e conservazione a -

80°C). Analisi mediante screening.

Si usa una sonda marcata con isotopi radioattivi o con fluorofori. L'obiettivo è trovare tra le

centinaia di migliaia e milioni di cloni diversi contenuti in una libreria il DNA di nostro interesse.

Da questo clone possono derivare tre tipi principali di informazioni:

– sequenza nucleotidica: si procede allo screening per ibridazione (uso di sonde marcate); è

possibile sia su librerie genomiche che a cDNA;

– sequenza proteica codificata: si usa uno screening immunologico;

– funzione della proteina codificata: tramite screening per complementazione.

Negli ultimi due casi, questo tipo di analisi può essere fatta solo su librerie a cDNA e sono se

vengono utilizzati dei vettori di espressione.

Sono vettori di espressione in batterio, ad esempio, tutti quelli che permettono lo screening

bianco/blu, che esprimono LacZ’ sotto il controllo di un promotore batterico.

Una libreria a cDNA clonata in un vettore di questo tipo avrà circa un clone su 3 in frame con LacZ’,

che darà origine ad una proteina di fusione espressa in batterio.

→ screening per ibridazione:

– Conosco solo un frammento di DNA e voglio isolare un cDNA intero o un frammento genomico

più grande.

– Conosco il gene che mi interessa, ma di un altro organismo (sequenza di DNA non 100% identica;

la sonda ibrida comunque).

Si costruisce la sonda in modo che leghi il mio frammento di cDNA o una sua porzione. Si aggiunge

la sonda solo sul filtro di nitrocellulosa con il DNA estratto dalle colonie.

I cloni che risultano positivi dopo analisi elettroforetica devono avere dimensioni anche diverse tra

loro, ma sempre maggiori o uguali a quelle della sonda.

→ screening con anticorpi:

Bisogna produrre anticorpi specifici per la proteina che si vuole analizzare: questo si fa inserendo la

proteina in un altro organismo e aspettare che questo produca gli anticorpi. Si estraggono e si

aggiungono al filtro di nitrocellulosa della libreria di espressione a cDNA.

Si selezionano le colonie marcate con anticorpi e si estrae il DNA: si controlla con elettroforesi e si

amplifica.

La PCR preparativa richiede che si conoscano le sequenze iniziale e finali del gene.

56

→ screening per complementazione funzionale:

Per esempio si può isolare il cDNA per l'enzima sulfito reduttasi di Zea mais, che compete

all'organicazione dello zolfo.

Se, ad esempio, si dispone di un mutante di E.Coli per il gene di interesse produttore di cisteina e

questo gene è essenziale per il batterio in certe condizioni di crescita, tutti i mutanti cresceranno

solo se si aggiungerà cisteina nel terreno poiché non riescono a produrla a partire dal solfato.

Il batterio mutante per la solfito reduttasi (Cys J), che non cresce in un terreno privo di cisteina,

viene trasformato con il DNA di una libreria a cDNA in un plasmide di espressione con l'aiuto di

proteine di fusione.

Alla fine della fase termica viene fatta un'estensione di qualche minuto per essere sicuri che tutte

le molecole siano complete.

Gli ampliconi incorporano sempre i primer; dopo la fase termica segue l'analisi elettroforetica:

-si usa gel di poliacrilamide per ampliconi di piccole dimensioni;

-si usa gel di agarosio per ampliconi di dimensioni >200-300bp.

Esiste anche la Real Time PCR che consente di visualizzare l'amplificato in tempo reale tramite

l'aumento della fluorescenza. Sintesi in vitro di DNA

PCR:

1. Componenti essenziali della PCR

2. Fasi termiche della PCR

3. Progettazione dei primer

4. Clonaggio degli ampliconi

5. Possibili problemi relativi alla PCR

6. Nasted PCR

7. Long PCR

8. Reverse Transcriptase-PCR (RT-PCR)

La PCR è la reazione a catena della polimerasi; si parte da un templato a doppio filamento che

viene denaturato per consentire l0appaiamento dei primer (anealing). Dopo l'appaiamento

avviene l'estensione del filamento complementare nuovo e la nuova denaturazione del dsDNA per

consentire l'appaiamento dei primer; in questo modo ricomincia il ciclo.

n

In teoria, il numero di ampliconi dovrebbe essere 2 dove n è il numero dei cicli di PCR effettuati. In

pratica, invece, a causa dell'esaurimento dei reagenti e della competizione nell'appaiamento dei

primer al templato, l'amplicone sarà stato amplificato di 200-1000 volte.

1) Componenti essenziali della PCR:

• DNA polimerasi termo-resistente (enzimi isolati da batteri termofili e ipertermofili )

Quantità di enzima: normalmente 1U per una reazione di 50 μl

P=DNA polimerasi proof-reading

• 2 oligonucleotidi (primer) con caratteristiche ottimali:

Lunghezza: 18-25 nt (es: 20mer)

Composizione in basi: G/C = 50%

Due C o G al 3’ dei primer

Assenza di self- complementarietà

Assenza di complementarietà tra i primer

Concentrazione in reazione: 0.1-0.5 μM 57

Temperatura di fusione (Tm): uguale o circa uguale per i 2 primer

Calcolo Tm (semplificata) = 2(A+T) + 4(C+G)

Calcolo Tm (corretta)= 81.5 + 16.6(log10 [Na+]) + 0.41(%(G+C))- 675/n)

Dove [Na+] = concentrazione molare di sodio (o potassio, influisce allo stesso modo) nel

tampone e n = lunghezza primer

• dNTP: Concentrazione in reazione: 20-200 μM

• Cationi bivalenti: Il Mg 2+ è indispensabile alla DNA polimerasi; viene aggiunto solitamente

come MgCl2 alla concentrazione solitamente 1.5mM. Il Mg incide sulla specificità di

appaiamento dei primer; se però si aumenta la concentrazione di Mg, diminuisce la

specificità dei primer.

• Tampone di reazione: Fornito dal produttore come 10X o 5X (con o senza Mg2+). Contiene

di solito KCl 50mM.

• Componenti opzionali: possono in alcuni casi permettere l’amplificazione di templati difficili

(es. ricchi in sequenze G/C) perché permettono una più facile denaturazione di tali templati

→ Formamide: 1,25-10% - DMSO: fino al 15% - Glicerolo: 1-10%.

• 5 6

DNA templato: Quantità: >10 -10 molecole bersaglio.

• Assenza di Inibitori: Molte sostanze possono inibire la DNA polimerasi; tra queste

ricordiamo: Proteinasi K, Fenolo ed EDTA

2) Fasi termiche della PCR:

Denaturazione: 94-95°C 30”-1’

Appaiamento dei primer: Tm primer-5°C 30”-2’ (Annealing)

Estensione: 72°C il tempo di estensione dipende dalla lunghezza del templato (1’ per ogni Kb)

Numero dei cicli: da 25 a 35 Real time PCR

Un fluorimetro accoppiato al termociclatore

permette di seguire l’amplificazione in «tempo

reale»; perché questo sia possibile, nella PCR viene

inserito un intercalante fluorescente. Si ha un

aumento esponenziale della fluorescenza.

Quando si arriva ad un numero elevato di cicli,

l'amplicone inizia a rinaturarsi e i primer vengono

esclusi (fase plateau).

Se non c'è templato si formano appaiamenti tra i primer e quindi sul gel risulta una banda quasi

invisibile: se nel controllo negativo la banda è visibile vuol dire che il campione è contaminato con

DNA diverso dal templato. Questo tipo di controllo è particolarmente importante nelle PCR

analitiche. Anche microcontaminazione della macchina possono interferire con la corretta

amplificazione.

3) Progettazione dei primer per l’amplificazione.

Per convenzione il primer si scrive sempre in direzione 5’→3’.

I due primer devono appaiarsi e avere i 3’ opposti, quindi essere convergenti.

58

Plus: è il filamento forward con direzione di sintesi 5' → 3' (lo stampo è il filamento opposto a

quello che viene mostrato in figura). Il primer plus quindi è sempre uguale alla sequenza data (la

sintesi procede da sinistra a destra).

Minus: direzione di sintesi opposta rispetto alla sequenza mostrata, ossia 5' → 3' (lo stampo è il

filamento in figura). Il minus è la sequenza complementare e ribaltata (scritta da 5' a 3').

Ogni primer ha una propria temperatura di melting, che dipende dalla lunghezza e dal numero di

coppie AT e GC. Per avere un buon appaiamento di entrambi, si sceglie come Ta, la temperatura di

anealing più bassa tra i due. Siccome i primer potrebbero appaiarsi anche in altre regioni del

genoma e dare quindi amplificati di dimensioni differenti, è sempre bene conoscere le dimensione

dell'amplicone desiderato.

Per definire la dimensione dell’amplicone conto le basi in paiabasi. Con questi primer posso

eseguire PCR analitica, cosi che non dia amplificazione né troppo piccola (poi la confondo con

primer dimer) però nemmeno troppo lungo perché rischio di rompere l’amplicone.

Nel caso della PCR analitica, non è necessaria l'amplificazione di una sequenza specifica, ma si

vuole solo che i primer si appaino, in modo da dimostrare che una determinata sequenza c'è

(oppure è simile) e abbia le dimensioni corrette. È spesso usata per definire se un DNA appartiene

o meno ad una determinata specie o se un gene (o un suo ortologo) è presente nel DNA del

campione.

Si possono costruire vari primer possibili. Esistono dei programmi computerizzati che forniscono la

sequenza di primer ottimale.La scelta della coppia da utilizzare va fatta in base:

a)Alle caratteristiche dei primer.

b)Devono appaiarsi al templato con direzione convergente.

c)Alla capacità di appaiarsi al templato in un solo punto specifico.

d)Alla dimensione dell’amplificato (amplicone), che non deve essere troppo piccolo (>150bp), per

non confonderlo con i “primer dimer” e neppure troppo grande (ad es. la Taq amplifica bene fino a

1000-2000bp). Esempio di coppia di primer:

• Primer PLUS: 5’ GACTGGTGCAAATACACAGC 3’

Tm = 10x4°C+10x2°C=60°C Ta=60°C-5°C=55°C

• Primer MINUS: 5’ GATATGGATTGAGAGCGTCC 3’

Tm = 10x4°C+10x2°C=60°C Ta =60°C-5°C=55°C

La Tm si calcola moltiplicando il n°C-G*4°C + n°A-T*2°C

La Ta si calcola sottraendo 5°C alla Tm: TA=Tm-5°C

Nel caso della progettazione in PCR preparativa o selettiva è necessario conoscere con precisione

la sequenza da amplificare. Tra le due temperature risultanti dai primer si deve prendere quella

minore se no si rischia di rompere uno dei due primer. Se i due primer hanno ΔT troppo grande si

deve modificare la dimensione di un primer (cosa che potrebbe cambiare le caratteristiche ottimali

del primer stesso e quindi rendere più difficile la reazione).

Es. Si vuole isolare la regione in grigio

Primer plus 5’ AACTTGCTGAGCATCCCCCAG 3’ Ta = 66°C-5°C = 61 °C

Tm = 12x4°C + 9x2°C = 66°C

Primer minus 5’ GTCCATCCCATCAAACACGTC 3’ Ta = 64°C-5°C = 59 °C

Tm = 11x4°C + 10x2°C = 64°C

Ta della PCR = 59°C

59

La posizione di appaiamento dei primer è fissa. Nella scelta della coppia si deve soddisfare almeno

la regola che la Tm dei primer sia all’incirca uguale (scarti di 2°C sono accettabili).

Nel caso si voglia cere la stessa temperatura di anealing, si accorcia uno dei due primer a partire

dal 3' finché non si è soddisfatti.

4) Clonaggio degli ampliconi

Si tratta di una delle procedure più difficili; il prodotto di una PCR non può essere immediatamente

clonato perché oltre agli ampliconi di dimensioni desiderate, possono esserci anche ampliconi più

piccoli o incompleti. Per questo motivo si procede con l'analisi elettroforetica e una volta ottenuta

la banda di dimensioni desiderate, la si ritaglia e si estrae il DNA dal gel. Questo tipo di

purificazione è detta per eluizione dal gel.

I prodotti di PCR vengono analizzati, a seconda delle dimensioni, mediante elettroforesi su gel di

agarosio o di poliacrilamide. Prima della clonazione gli ampliconi vengono solitamente purificati

per eluizione dal gel. È una procedura molto complessa che ancora oggi si lavora per semplificare.

Si rischiano di clonare i primer dimer, quindi il primo passaggio è la purificazione dal gel per isolare

l’amplicone. Poi va inserito in un plasmide. Inizialmente di usava la TAQ polimerasi; si usavano

estremità piatte con continui insuccessi.

Poi ci si è resi conto che la PCR lascia un DNA ad estremità piatte quindi può essere clonato in un

DNA lineare. Durante la PCR si ha che l’amplicone in 5’ non è fosforilato; inoltre il plasmide si

richiude più facilmente (ha estremità piatte quindi ligazione difficile). Si deve quindi aggiungere P

per defosforilare il plasmide da clonare (fosfatasi) e una chinasi per fosforilare l’amplicone.

Il tipo di clonazione varia a seconda della DNA polimerasi utilizzata durante l'amplificazione:

a) Ampliconi prodotti con DNA polimerasi proof-reading

Queste polimerasi producono solitamente ampliconi con estremità piatte, i quali possono essere

clonati in vettori opportuni (plasmidi linearizzati), digeriti con enzimi di restrizione che creano

terminazioni piatte (blunt). Per evitare che il vettore, essendo fosforilato al 5', si richiuda su se

stesso senza trasformare, è necessario fosforilare i primer della sequenza da amplificare prima

della PCR (i primer normalmente sono prodotti defosforilati). Questo tipo di polimerasi è usata per

l'alta efficienza (bassa frequenza d'errore) e quindi è l'ideale nelle PCR preparative.

b) Ampliconi prodotti con Taq

La Taq e altre DNA polimerasi termoresistenti non proof-reading possiedono un’attività di

transferasi terminale templato-indipendente. Essa attacca solitamente un dNTP al 3’ degli

ampliconi, e preferenzialmente un dATP.

Si può procedere con due metodi di clonaggio:

• utilizzo di “TA cloning vector”: sono vettori già linearizzati che possiedono nel sito di

clonaggio l'estremità 3' con una T protrudente capace di appaiarsi alla A presente

sull'amplicone.

• Uso della DNA polimerasi proofreading con attività 3'→5' esonucleasica (es. DNA

polimerasi T4, Pfu DNA polimerasi) per rendere “blunt” le estremità (attività) e permettere

la clonazione n un vettore con taglio tipo “blunt.”

Si usa una proofreading quando si vuole clonare per evitare mutazione durante la clonazione però

produce estremità piatte; la non-proofreading si fa con la Taq polimerasi che aggiunge le A per

creare delle estremità A-protrudenti. 60

Altri metodi di clonazione degli ampliconi

- Mutagenesi delle terminazioni per aggiunta di siti di restrizione specifici:

Questi siti di restrizione vengono aggiunti al 5’ dell’oligonucleotide che funziona da primer; gli

enzimi usati non devono avere siti all'interno dell'amplicone!

In PCR progetto i primer del templato, il 3’ deve essere appaiato e in base a questo calcolo la T di

melting. Al 5’ posso aggiungere delle altre parti corrispondenti a siti di restrizioni, che non vanno

ad influire sul calcolo della temperature. In questo modo creo una reazione di PCR terminale

ovvero posso creare un amplicone che può essere tagliato con strutture di restrizione.

Il taglio, la digestione, posso farla con enzimi di restrizione, ma devo stare attento a che non ci

siano gli stessi siti di restrizione introdotti per il taglio alle estremità anche all’interno della

sequenza dell’amplicone (per questo devo conoscere tutta la sequenza dell’amplicone) così se

voglio tagliare alla estremità non taglio anche all’interno dell’amplicone stesso.

- Ligazione mediante topoisomerasi coniugate al vettore: topcloning

è apposta per la Taq e per estremità piatte. Si tratta di un brevetto segreto che costa parecchio. In

linea di principio si usano delle ricombinasi sito specifiche e delle sequenze ben precise sia sul

vettore che sull'inserto amplificato. Il sistema permette anche di subclonare in un diverso vettore.

La reazione di ligazione è estremamente rapida, non si usa la DNA ligasi.

-Inserimento e scambio mediato da ricombinasi sito-specifiche

Si usano delle ricombinasi che riconoscono sequenze presenti sia sul vettore sia sull'esogeno e che

permettono la ricombinazione delle sequenze comprese tra questi due siti; richiedo quindi una

ben determinata sequenza che deve essere presente sia nel vettore che nell’amplicone, in

quest’ultimo caso posso inserirla con una mutagenesi terminale.

Una soluzione simile è quella si inserire delle sequenze omologhe al vettore nelle estremità

dell'amplicone e poi procedere alla ricombinazione in vitro tramite crossing-over.

Ricombinasi Cre del fago p1 Riconosce e ricombina siti loxP

Proteine Ricombinanti di λ (ricombinasi + proteine accessorie) Riconoscono e ricombinano siti

attivi. I siti riconosciuti dalle ricombinasi devono essere presenti sui plasmidi di clonaggio ed

inseriti nell’amplicone alle estremità attraverso l’uso di primer modificati al 5’.

Gate way (costosissimo):Il plasmide a cui è stato aggiunto l'amplicone viene definito “plasmide

donatore”, in soluzione viene poi aggiunto un vettore shuttle caratterizzato dal promotore di

mammiferi (espressione in cellule di mammifero). Viene poi aggiunta Cre ricombinasi per

permettere l'inserzione dell'amplicone del plasmide donatore nel vettore shuttle subito dopo il

promotore di mammifero; l'inserzione avviene tramite siti d’inserimento della ricombinasi.

La reazione funziona al 50%.

In questo sistema non importa il sito di ricombinazione , non importa se non conosco la sequenza

dell’amplicone da fare. Nella topoisomerasi o nella sito specifica non si hanno siti di restrizione

quindi non si pone il problema di distruggere la molecola.

-Inserimento da ricombinazione omologa in vitro:

richiede l’intervento di proteine, ma è presente in tutti gli organismi. Avviene solo se abbiamo

sequenze di omologia, possiamo farla sia in vivo che in vitro (dove si devono aggiungere proteine

responsabili della ricombinazione). Si ha taglio del plasmide, inserimento dell’amplicone con agli

estremi le sequenze omologhe del plasmide aperto, doppio X-over (si ha da purificazione di

proteine responsabili) ed inserimento dell’amplicone con contemporanea chiusura del plasmide.

61

- One-step cloning

è una metodologia piuttosto vecchia, molto di moda 10 anni fa. Il vettore può anche essere chiuso,

basta che contenga un sito unico di restrizione.

Nello stesso tubo si inserisce il plasmide circolare, l’amplicone, l’enzima di restrizione che genera

estremità piatte e la DNA ligasi; se l'enzima taglia a livello del sito si ha linearizzazione del vettore,

ma si può richiudere. Quando casualmente (reazione deve andare per tanto trempo) si inserisce

l'amplicone, questo distrugge le estremità di restrizione così che il ricombinante si accumuli nel

tempo.

Problema della contaminazione di DNA

Se l’operatore non lavora correttamente può introdurre inavvertitamente DNA estraneo (diverso

dal templato) che può dare amplificazione. Il DNA contaminante può essere presente nelle

soluzioni usate, nell’enzima, nei primer, sul materiale utilizzato per assemblare la reazione. Una

reazione fatta in parallelo senza aggiunta di DNA templato costituisce il controllo negativo e, in

assenza di contaminazione, non deve dare amplificazione.

Dalla reazione negativa ci si aspetta zero amplificazione (se invece c’è è perché c’è stata

contaminazione).

Metodi per ridurre il rischio di contaminazione:

a)La reazione deve essere assemblata in un ambiente dedicato alla PCR (spesso sotto cappa flusso

laminare, ma questo è per sterilizzazione quindi non esclude la presenza di DNA. Si usa plasticheria

sottoposta ad altre temperatura o a raggi UV per sterilizzare e denaturare il DNA.

b) Si deve utilizzare plasticheria speciale (puntali, provette) DNA- e RNA-free. I puntali utilizzati

presentano un filtro per impedire la contaminazione dovuta alle pipette automatiche.

c)Le pipette, le provette, e alcune soluzioni vengono trattate ai raggi UV che, producendo dimeri di

timina, impediscono al DNA contaminante di dare amplificazione. Fornetti UV in cui si mettono

tutti i materiali per impedire la eventuale ricombinazione di DNA. Anche la macchina va pulita

quindi o la si irradia anch’essa con UV o la si lava con ipoclorito di sodio.

d)Se la PCR viene utilizzata per scopo analitico si può ricorrere al metodo della Uracil-N-glicosilasi.

Poiché la contaminazione deriva spesso da ampliconi ottenuti in reazioni di PCR precedenti,

l’amplificazione può essere eseguita con dUTP, anziché dTTP. L’amplicone si forma normalmente e

può essere rilevato mediante elettroforesi su gel. Le amplificazioni successive vengono iniziate in

presenza dell’enzima Uracil N-glicosilasi che è in grado di staccare l’uracile da qualunque DNA

contenente dU, che in tal modo non può più funzionare da templato. All’inizio della PCR verranno

perciò distrutti tutti i DNA derivanti dalle amplificazioni precedenti e, dopo la prima fase di

denaturazione di tutte le molecole, inattivante anche l’enzima Uracil N-glicosilasi, la PCR potrà

proseguire indisturbata. L’enzima non è termoresistente quindi viene distrutto nella prima fase,

prima che cominci la vera e propria PCR.

Problema della mancata amplificazione 62

Alcune volte non di osserva amplificazione ed è necessario provare diverse condizioni di PCR per

ottenere l’amplificato desiderato.

Possibili cause:

a) I primer non si appaiano perché sono errati o perché le condizioni di annealing sono troppo

stringenti (Ta troppo elevata, contenuto di Mg2+ troppo basso, ecc.)

b) Uno dei componenti di reazione (dNTP, Tampone, DNA polimerasi, ecc.) è degradato o alterato.

c) Il templato è degradato.

Se si dispone di un DNA clonato, capace di amplificare con facilità con gli stessi primer usati, può

essere assemblata una reazione di PCR parallela, la quale costituirà il controllo positivo.

Esistono in commercio “kit” che forniscono tamponi di reazione a pH e concentrazioni di Mg2+

differenti e permettono perciò di testare un numero notevole di condizioni di reazione. Più

aumento il Mg2+ più c’è la probabilità che il primer si appai, ma se è troppo il primer potrebbe

appaiarsi nel posto errato.

Problema di amplificazioni indesiderate

Oltre alla formazione dei primer dimer, difficilmente eliminabili, la PCR può dare talvolta

amplificazioni indesiderate, cioè di dimensioni o sequenza differenti da quelle previste.

Questo può dipendere da:

a) Aspecificità dei primer: i primer si appaiano su altri punti del DNA templato o su altri templati

b) Contenuto di Mg 2+ troppo elevato

c) Temperatura di annealing troppo permissiva

d) Rampa iniziale della PCR (25°C > 95°C). Per ovviare a quest’ultimo inconveniente si può ricorre al

“Hot Start”.

In quest'ultimo caso, il problema dipende dalla ripidità della rampa, ossia dal tempo che il DNA

impiega a denaturarsi completamente alla T di 95°C. Se la denaturazione è troppo lente, i primer

possono appaiarsi già a 40°C (ossia ad una temperatura più bassa della Ta) in regioni diverse da

quelle complementari. A 40°C la polimerasi funziona comunque, anche se non a pieno regime: in

questo modo, si crea, anche se lentamente, un amplicone spuro, diverso da quello desiderato, via

via che si procede con i cicli di amplificazione. Per ovviare a ciò, esistono termociclatori a luce in cui

la rampa iniziale rapidissima e quindi il numero di ampliconi collaterali è molto basso. Di norma la

rampa dura all'incirca 20 secondi; se non si ha a disposizione un termociclatore a luce, la soluzione

può essere far partire la reazione direttamente al grado 95, omettendo i primer, la polimerasi o i

dNTP fino al raggiungimento della temperatura massima. Questo procedimento è detto hot spot.

Di norma si tende ad omettere i dNTP.

Si usa della cera per separare un componente dal resto della reazione: la cera fusa viene aggiunta

alla reazione (nella quale è stato omesso uno dei componenti di reazione) e viene lasciata

solidificare. Sopra si aggiunge il componente di reazione mancante. Quando si raggiungono i 95°C,

la molecola si denatura e la polimerasi precedentemente bloccata (es. Taq Gold) si attiva.

Touchdown PCR: quando non si conosce la Ta.

Viene realizzata quando non si conosce la corretta temperatura di annealing dei primer e si

vogliono evitare molte prove di PCR a varie temperature di annealing allo scopo di trovare le

condizioni migliori.

Questo può capitare quando si hanno primer progettati su un gene omologo di un altro organismo,

ma non si conosce esattamente il numero e la posizione dei mismatch: questi non vanno

considerati nel computo della Ta.

Nella touchdown PCR si testano in una sola reazione varie temperature di annealing.

63

La temperatura nelle varie fasi termiche dei cicli viene mantenuta invariata, eccetto la temperatura

di annealing:

• 1) Si effettuano 2 cicli a una temperatura annealing superiore a quella usata normalmente

(es. uguale alla Tm).

• 2) Si eseguono altri 2 cicli a una temperatura di annealing diminuita di 1°C rispetto a quella

precedente.

• 3) Si continuano a eseguire coppie di cicli diminuendo di 1°C ogni volta la temperatura di

annealing fino a realizzare 10 coppie di cicli.

• 4) Si eseguono infine altri 20-30 cicli aggiuntivi a una temperatura di annealing

corrispondente a quella raggiunta dall’ultima coppia (T annealing iniziale -10°C).

Anche se la temperatura di annealing raggiunta con

l’ultima coppia di cicli e i 20-30 cicli aggiuntivi è più

bassa di quella ottimale (nell’es. 55°C), l’amplificazione

sarà comunque specifica perchè i primi ampliconi

prodotti a 63°C diventano essi stessi il templato per i

cicli successivi.

Nest PCR.

Si usa quando:

– conosco una regione su cui progettare i primer;

– ottengo l'amplicone delle dimensioni desiderare, ma non conosco completamente la sequenza.

Per evitare di sequenziare l'amplicone progetto dei primer più interni di quelli precedenti per

verificare se la sequenza è veramente quella desiderata.

Long PCR.

In condizioni standard una reazione di PCR permette di amplificare frammenti di 1-2 kb.

Questa capacità è spesso insufficiente per amplificare un cDNA “full length” o un intero gene dal

DNA genomico (fino a 20-30Kbp); varie sono le cause che impediscono l’amplificazione di lunghi

frammenti con una PCR standard (con Taq):

1) Difficoltà di denaturazione di molecole di DNA molto lunghe

2) Templati danneggiati

3) Insufficiente processività delle DNA polimerasi come Taq. Non avendo attività esonucleasica

3’→5’, si verificano incorporazioni errate che causano il blocco dell’estensione.

4) Percentuale di errore inaccettabile per l’amplificazione di lunghi frammenti

Per queste PCR lunghe si ricorre normalmente a una miscela di 2 DNA polimerasi termostabili

differenti. Una delle DNA polimerasi è efficiente nell’amplificazione, ma è “error-prone” (Klentaq),

l’altra (Pfu), usata in minore quantità, fornisce l’attività esonucleasica 3’->5’ che permette di

eliminare gli errori. Reverse-Transcriptase-PCR (RT-PCR).

L’amplificazione di un cDNA di interesse (di cui si conosce la sequenza) può essere eseguita

direttamente a partire dall’mRNA totale mediante una RT-PCR.

a) L’mRNA viene retrotrascritto a cDNA (a singolo filamento) mediante la trascrittasi inversa. Il

primer utilizzabile può essere:

– un primer oligo(dT) (mRNA totale -> cDNA totale)

– una miscela di primer random (esameri) (mRNA totale -> cDNA totale)

– un primer specifico (genespecific primer, GSP) (GS mRNA -> GS cDNA).

64

b) Il cDNA a singolo filamento (cDNA totale o GS cDNA) viene usato come templato per la reazione

di PCR successiva gene-specifica. Il primo ciclo di PCR del filamento ss, lo converte in ds.

Mutagenesi Terminale mediante PCR.

Si può aggiungere o togliere una o più basi alle estremità della sequenza da amplificare.

Se si vuole amplificare una sequenza di più di 100bp lo si fa per amplificazioni successive.

(ovviamente esistono altre tecniche più semplici).

Esercizio: Se si vuole isolare la regione compresa tra i due primer e aggiungere all'estremità 5' il

sito di restrizione EcoRI (GAATTC) e al 3' il sito di restrizione HindIII (AAGCTT).

Primer PLUS 5'GAATTCAACTTGCTGAGCATCCCCCAG3'

Tm: 12*4°C + 9*2°C = 66°C Ta: 66°C-5°C = 61°C

Primer MINUS 5'AAGCTTGTCCATCCCATCAAACACGTC3'

Tm: 11*4°C + 10*2°C = 64°C Ta: 64°C-5°C = 59°C

Ta della PCR = 57°C

non si contano mai nella Tm le bp aggiunte con i siti di restrizione.

(Occhio a posizionare bene il sito di restrizione sul primer minus)

La Tm della regione in comune deve essere maggiore o uguale alla Tm dei primer.

65

Se la porzione in comune é: -

5'GGCTTCCCATTCAAGCCGGCGTGCCAGCGTCACGACTTTGGATACCGGAACTACCAGGTCCAATTCCATTTT

AGCCCGCGTGCTAGATGGAAGATTGACG3'-

La dimensione del prodotto di fusione si calcola sommando le bp dei due frammenti; alla somma si

sottrae la porzione in comune che altrimenti sarebbe ripetuta due volte nel calcolo. In questo caso

la dimensione è di 750bp.

È possibile fondere insieme in maniera direzionata sequenze che non hanno regioni in comune

aggiungendo queste ultime tramite mutagenesi.

Assemblare 3 reazioni di PCR 66

Mutagenesi sito-specifica per PCR

Inserzione o delezione di più nucleotidi in posizione centrale

Si vuole aggiungere, per esempio, una sequenza di 9bp. Con l'uso della PCR il procedimento

diventa molto più accurato che con il clonaggio. Per l'inserzione e per la delezione si fa mutagenesi

intorno al sito di inserzione, progettando dei primer che diano due ampliconi separati. Per fonderli

successivamente, questi ampliconi devono avere delle sequenze in comune, che combacino. Si

devono calcolare 5 Tm, 4 per i primer e una per la zona di appaiamento. Questa zona da sola,

tuttavia, non è sufficiente e bisogna estenderla lateralmente, progettando i primer complementari

in modo che contengano anche una porzione della sequenza all'esterno. Nello stesso modo si può

eseguire una delezione per PCR. Si fanno anche in questo caso tre PCR, in cui le Ta delle due coppie

di primer devono essere circa uguali. Si progettando i primer, in modo che contengano una piccola

parte intorno alla zona deleta, per facilitare la fusione.

Esercizio: modificare la sequenza sotto riportata inserendo nel punto indicato dalla freccia rossa la

sequenza 5'GTTGATACCAT3'. 67

Mutagenesi sito-specifica per estensione del primer.

Prima dell'avvento della PCR, la mutagenesi era

molto più complicata. Si usavano dei primer

mutagenizzanti e una DNA polimerasi priva di

attività EXO 5' – 3' (che eliminerebbe la

mutazione) (per esempio Klenow). Si formava così

un eteroduplex, che veniva poi usato per

trasformare dei batteri competenti. Nonostante in

teoria, il batterio non fosse in grado di distinguere

tra i due filamenti (ossia il risultato avrebbe

dovuto essere 50% e 50%), si otteneva quasi

sempre, un 99,9% wt e solo 0,1% mutato. Questo

avveniva perché il sistema di riparo riconosceva il

parentale metilato ed era quindi in grado di

correggere correttamente la differenza.

Per evitare l’analisi di un numero notevole di cloni

si ricorre a strategie per ridurre al minimo le

placche o colonie non mutate.

Es. Eliminazione di un sito di restrizione. Se per la

ricostruzione del singolo filamento si utilizza una

DNA polimerasi mancante di attività EXO 5’->3’, si

possono inserire nella stessa molecola più primer

mutagenici. Uno di questi può essere utilizzato

per eliminare una sito di restrizione nella molecola parentale. L'eliminazione può essere poi

sfruttata per la selezione delle colonie con il filamento mutato. Dopo la trasformazione si ottiene

sempre 9% wt e 0,1% mut, ma se si estrae il materiale genetico, lo si sottopone a taglio con enzimi

di restrizione che riconoscono il sito mutato e si usa questo stesso DNA per ritrasformare dei

batteri, l'efficienza di trasformazione cambia: 60% Mut e 40% wt. Il DNA wild-type, viene reso

lineare dall’enzima, trasforma E.coli a bassa efficienza, mentre il DNA mutato resta circolare e

mantiene un’alta efficienza di trasformazione. 68

Mutagenesi quick – change.

DpnI è un enzima di restrizione che digerisce i siti metilati ed emimetilati. Il DNA plasmidico

preparato dai ceppi di E.coli dam+ normalmente utilizzati in laboratorio, risulta essere metilato su

entrambi i filamenti nella sequenza GATC ed è perciò tagliabile con DpnI.

Viceversa il DNA sintetizzato in vitro con i canonici dNTP risulta non metilato e perciò resistente a

DpnI. Si usano quindi due primer mutageni, uno complementare all'altro, per fare una sorta di PCR

circolare. Alla fine della PCR si otterrà un tubo contenente:

– wt circolare;

– mut circolare omoduplex (in quantità maggiore rispetto agli altri);

– mut circolare eteroduplex.

La miscela può essere poi usata per trasformare, dopo aver aggiunto DpnI, in modo che tutto il

DNA diverso dall'omoduplex venga distrutto.

Sequenziamento del DNA.

Molto difficile, se non quasi impossibile, è il sequenziamento delle proteine. Anche sequenziare

l'RNA è piuttosto difficile. Alla fine degli anni '60 furono sviluppati due metodi per il

sequenziamento del DNA: quello di Sanger e quello di Maxam e Gilbert.

Metodo di sintesi enzimatica di Sanger.

Oggi questo metodo è stato automatizzato per renderlo ancora più efficiente. Recentemente si

stanno diffondendo le cosiddette New Generation Sequencing Technology, che non seguono più

l'idea sviluppata da Sanger.

Il metodo di sequenziamento secondo Sanger sfrutta due proprietà delle DNA polimerasi:

a) Impiegando un filamento singolo di DNA come stampo, sono capaci di sintetizzare in vitro un

nuovo filamento complementare, a partire dai singoli dNTP. Per iniziare la sintesi necessitano di

una piccola regione di DNA a doppia elica con un -OH 3’, che viene ottenuta solitamente facendo

appaiare al DNA stampo un oligonucleotide detto primer.

b) Sono in grado di incorporare nella catena nascente dei nucleotidi trifosfato modificati: 2’,3’

dideossiribonucleotidi trifosfato (ddNTP). Mancando dell’OH in 3’, una volta incorporati, la catena

non può più essere allungata.

Schema generale del metodo:

1) Il DNA da sequenziare viene preparato come DNA a singolo filamento e diventerà il templato

della DNA polimerasi.

2) Un oligonucleotide sintetico viene appaiato al DNA da sequenziare. Il primer deve essere

marcato (ad esempio radioattivamente), di solito all'estremità 5' e aggiunto in eccesso molare.

3) Alla miscela DNA + primer si aggiunge la DNA polimerasi, il tampone di reazione e i dNTP. Essa

viene quindi divisa in 4 frazioni a ognuna delle quali viene aggiunto un diverso ddNTP.

Le frazioni vengono portate a una temperatura tale da dare inizio alla reazione (37°C), in ogni

frazione, il rapporto tra la concentrazione dei dNTP e quella dello specifico ddNTP è tale da

permettere l’allungamento della catena, prima che l’inserimento casuale del ddNTP non la

interrompa definitivamente (circa 1:100).

Alla fine della reazione, ogni frazione è costituita da una miscela di DNA estesi, tutti marcati

radioattivamente, di varia lunghezza e tutti terminanti con lo stesso ddNTP, inoltre, la lunghezza dei

frammenti dipende dalla posizione che la base complementare al ddNTP presenta sul DNA stampo.

A questo punto si caricano le 4 frazioni sul gel elettroforesi denaturante (8M urea), in modo che i

frammenti si separino in base alle dimensioni. Lo schema di caricamento è sempre CATG, in modo

da facilitare la lettura (soprattutto una volta quando questa era manuale e non computerizzata).

69

Un gel di sequenziamento si legge dal basso verso l'alto. Le stesse quattro frazioni si caricano tre

volte, interrompendo la corsa in tempi diversi, in modo da riuscire a leggere nel modo migliore

possibile la sequenza. Anche la tempistica di caricamento è importante: se ci si impiega troppo

tempo il DNA già caricato si denatura nei pozzetti, al contrario se ci si mette troppo poco tempo

non si lascia un tempo di denaturazione sufficiente prima della corsa.

Dalla prima reazione ideata da Sanger, il metodo è stato notevolmente modificato e le principali

modifiche apportate riguardano:

a) Preparazione del templato a singolo filamento

b) DNA polimerasi impiegata nella sintesi

c) Reazione di marcatura

d) Separazione elettroforetica dei prodotti di estensione.

a.) Preparazione del templato a singolo filamento

Il DNA da sequenziare veniva clonato nella RF di M13 (o in un fagemide) e si isolava dai virioni il

DNA a singolo filamento. Per sequenziare veniva usato un primer universale che si appaiava alla

sequenza di M13 vicina al sito di clonaggio. Per sequenziare il filamento complementare, il

frammento di DNA doveva essere inserito in direzione opposta. La denaturazione con alcali,

seguita da precipitazione alcolica, ha permesso il sequenziamento diretto delle preparazioni

plasmidiche evitando così il subclonaggio del DNA da sequenziare. L’uso di 2 primer, “forward” e

“reverse”, che si appaiono su i due filamenti opposti ai lati del sito di clonaggio, consente il

sequenziamento nelle 2 direzioni. Con l’avvento delle DNA polimerasi termo-resistenti, la

denaturazione viene ottenuta per riscaldamento.

b.) DNA polimerasi impiegata nella sintesi

Il primo enzima utilizzato da Sanger era il frammento Klenow della DNA polimerasi I di E. coli, che

manca rispetto all’enzima nativo dell’attività esonucleasica 5’-->3’

Svantaggi:

• Bassa processività (si stacca dal templato dopo 300 basi).

• Funziona a 37°C (non riesce a copiare templati con strutture secondarie, come omopolimeri

o sequenze palindromiche).

Per risolvere le sequenze omopolimeriche era spesso usata la trascrittasi inversa murina o aviaria

(esse sono anche DNA polimerasi DNA dipendenti).

Successivamente è stato introdotto l’enzima Sequenase derivante dalla DNA polimerasi del fago

T7; è la forma chimicamente modificata della DNA polimerasi del fago T7, attuata per ridurne

l’attività 3’->5’ EXO. Sequenase 2.0 è la versione ricombinante che manca completamente

dell’attività 3’ ->5’ EXO.

Vantaggi:

• Ha elevata processività (2000-3000 basi), ben oltre la capacità risolutiva del gel di

sequenziamento.

• Tollera bene gli analoghi dei dNTP (come dITP, 7-deaza-dGTP) utilizzati per risolvere la

compressioni nel gel dovute ad appaiamenti intramolecolari dei prodotti di reazione.

L’introduzione delle DNA polimerasi termoresistenti, come Taq, che funzionano a 70-75°C:

Vantaggi:

• Ha permesso di sequenziare DNA con estese strutture secondarie, normalmente stabili a

37°C (come le strutture a forcina). 70

• Effettuando diversi cicli di temperatura nelle reazioni di terminazione, è possibile

amplificare linearmente i frammenti marcati e quindi sequenziare templati presenti a basse

concentrazioni

L’ultima DNA polimerasi prodotta appositamente per il sequenziamento è la Thermosequenase,

una proteina ricombinante derivante dalla fusione della Sequenase (forma chimicamente

modificata della DNA polimerasi del fago T7, attuata per ridurne l’attività 3’->5’ EXO) con la Taq.

Vantaggi:

- Funziona come la Taq ad alte temperature.

- Elevata processività.

- Dà una successione di bande migliore perché utilizza tutti e 4 i ddNTP con la stessa

efficienza (cioè non ha preferenze).

La thermosequenasi è l'enzima che si usa normalmente oggigiorno.

c.) Reazione di marcatura

– 32

Inizialmente il primer veniva marcato per fosforilazione dell’estremità 5’ con P-ATP

mediante l’enzima polinucleotide kinasi

– L’ultimo tipo di marcatura è quello che viene ottenuta utilizzando i ddNTP marcati sul P-α

(non sul γ com'era per la marcatura dei primer), cosicché la porzione marcata sia sul 3' e

tutti i frammenti derivanti dalla terminazione siano marcati.

La marcatura può essere:

– 33 33

Radioattiva con l’isotopo P (α[ P]ddNTP): La rilevazione avviene per autoradiografia

– Fluorescente: La rilevazione avviene per eccitazione con un raggio laser e misura della

emissione fluorescente

A questo punto anche i ddNTP potevano essere visti per tramite il fuoroforo.

Se viene usato un solo tipo di fluorescenza, si devono eseguire le classiche 4 reazioni di

terminazione separate e 4 corsie separate nel gel di sequenziamento. Se vengono utilizzate 4

gruppi fluorescenti differenti per i 4 ddNTP, la reazione di terminazione è unica, viene caricata in

una sola corsia del gel e la successione delle bande può essere letta in continuo da un raggio laser

collegato a un computer che elabora i dati; si usa un'elettroforesi capillare con gel di poliacrilamide

denaturante. Se si hanno quindi 4 fluorofori differenti si possono distinguere i ddNTP in un'unica

reazione grazie alla fluorescenza diversa. Vengono inoltre caricata in un'unica colonna per la corsa.

Se poi si scannerizza la corsa elettroforetica con un laser si hanno i picchi di fluorescenza. Il

computer poi decodifica i colori e si ha quindi il cromatogramma che stabilisce la sequenza.

d.) Separazione elettroforetica dei programmi di estensione

Sequenziamento automatico con ddNTP marcati con fluorescenza.

Elettroforesi capillare: ogni reazione viene caricata in un capillare; una macchina è in grado di

leggere, con una singola corsa 96 campioni differenti.

Un frammento di DNA da sequenziare viene solitamente clonato in un vettore plasmidico e

sequenziato con un primer che si appaia al vettore nella regione intorno al sito di policlonaggio.

I primer che si appaiono al vettore sono detti universali perché possono essere utilizzati per

sequenziare qualunque frammento clonato in tale vettore (ad es. tutti i cloni di una libreria

plasmidica). 71

Sequenziamento di prodotti di PCR

1) Sequenziamento diretto

L’amplicone deve essere prima purificato per togliere tutti i componenti di reazione (primer, dNTP,

DNA polimerasi) ed eventuali ampliconi indesiderati (primer-dimer).

Poi si esegue il sequenziamento diretto utilizzando uno dei due primer usanti in PCR.

Primer plus e Primer minus comportano una perdita di basi.

2) Sequenziamento dopo il clonaggio

L’amplicone viene prima clonato in un vettore plasmidico. Il sequenziamento viene eseguito con un

primer universale (forward oppure reverse) che si appaia al vettore nella regione intorno al sito di

policlonaggio.

L'unico caso in cui non si riesce a far diventare del DNA a singolo filamento a doppio filamento

succede nel caso dei primer dove si usa il sequenziamento di maxwel e Ghilbert; però costano

talmente poco che si fa rifare il primer dalla ditta. (dai 4 ai 6 euro).

Sequenziamento di frammenti di DNA lunghi

A causa della ridotta capacità risolutiva del gel denaturante, ogni reazione di sequenziamento

permette di sequenziare da 300-400 basi (sequenziamento manuale) a 700-1000 (sequenziamento

automatico). Se il frammento di DNA da sequenziare supera queste dimensioni si deve ricorrere a

procedure particolari.

1) Procedura “Primer walking”: Viene utilizzata per sequenziare

frammenti di DNA di piccole

dimensioni (<10kb), ma

comunque superiori alle

dimensioni possibili con il

normale sequenziamento.

2) Procedura “shotgun” Viene

utilizzata per sequenziare

frammenti di DNA di grandi

dimensioni (>10kb) fino al

sequenziamento di interi genomi

Vengono generati frammenti

casuali e sovrapposti che sono poi

clonati in un opportuno vettore.

Il DNA da sequenziare viene

purificato, viene frammentato per

sonicazione o nebulizzazione; le

estremità dei frammenti di DNA

vengono riparate e i frammenti

sono clonati in un vettore

opportuno, generando una

libreria.

Universal primer: Utilizzando un primer universale si sequenziano un numero notevole di cloni Il

sequenziamento per ogni clone può essere solo parziale; es 800-1000 basi dal primer.

Con l’ausilio di un computer si allineano le sequenze e dei frammenti e si assemblano fino a

completare l’intera sequenza del DNA. 72

Metodo di degradazione chimica di Maxam e Gilbert

La degradazione chimica è una metodologia che implica la frammentazione del DNA con l'uso di

sostanze chimiche sequenza specifiche; per prima cosa si isola il frammento di DNA da sequenziare

e lo si marca radioattivarnente a una sola delle estremità.

Esistono vari metodi di marcatura ad un’estremità:

a) Si marca il DNA ad entrambe le estremità (sostituzione del fosfato in 5’ con 32P

mediante la polinucleoide kinasi, attacco al 3’di dNTP radioattivi mediante la transferasi terminale,

riempimento di estremità adesive 5’ protrudenti con dNTP radioattivi e DNA polimerasi, ecc.). Si

possono poi separare i due filamenti mediante elettroforesi denaturante oppure si può tagliare,

mediante enzimi di restrizione, il DNA marcato in 2 frammenti che vengono successivamente

separati per elettroforesi nativa.

b) Si marca il DNA a doppio filamento ad una sola delle estremità

Il DNA marcato viene suddiviso in 4 o 5 campioni ognuno dei quali viene trattato con un reagente

chimico che modifica 1 o 2 delle 4 basi del DNA. Le condizioni di reazione sono controllate in modo

tale che in ciascuna molecola del DNA vengano intaccati solo pochi siti.

Il trattamento con piperidina catalizza la scissione del filamento ove la base è modificata. Ciò

produce una serie di frammenti marcati la cui lunghezza dipende dalla distanza della base

modificata dall’estremità marcata della molecola.

Le 4 o 5 reazioni vengono caricate su un gel di poliacrilamide denaturante ad alta risoluzione e

sottoposte a separazione elettroforetica.

Mediante autoradiografia è possibile visualizzare i frammenti marcati prodotti dalle 4 o 5 reazioni

come serie cli bande disposte su 4 corsie. Dalla successione delle bande è possibile dedurre la

sequenza anche se non con la stessa accuratezza possibile con il metodo di Sanger.

Espressione di proteine ricombinanti

Si tratta di proteine espresse in particolari ospiti tramite tecniche ricombinanti; queste

metodologie vengono sfruttate quando si vuole produrre grandi quantità di peptidi e a basso

costo. scopi:

• Ottimizzazione della trascrizione

• ottimizzazione della traduzione

• vettori di espressione

• purificazione della proteina ricombinante

Procedimenti:

-isolamento del DNA che codifica le proteine ricombinanti

-trasferimento in un ospite differente da quello di partenza per l'espressione di questa proteina.

L'ospite viene detto ricombinante a patto che sia in grado di esprimere la proteina.

La proteina che si ottiene può servire a scopo scientifico (ricerca sulle proprietà strutturali e

funzionali) oppure pratico (ha ricadute industriali e farmaceutiche importanti).

Espressione genica in sistemi eterologhi

I geni vengono espressi in sistemi eterologhi per ottenere grandi quantità di peptidi e a basso

costo. 73

Organismi trasgenici: sono quegli organismi in cui è stato inserito il gene che deve dare la proteina

ricombinante.

L'esempio più eclatante di ospite usato come sistema eterologo è E.Coli.

Per esprimere un gene eterologo bisogna definire due componenti:

– Un ospite per l’espressione

– Un vettore d’espressione

Espressione di proteine ricombinanti in E. coli

È la prima scelta per la produzione di proteine di medie dimensioni (100-250 aa) senza

modificazioni post-traduzionali

Vantaggi:

• Numerosi vettori specifici

• Efficienza di trasformazione molto alta

• Crescita molto rapida ed economica

• Alti livelli di espressione

• Recupero e lisi cellulare molto semplice

• Procedure di scaling up facili (es. fermentatori industriali)

Svantaggi :

• Nessuna modificazione post-traduzionale della proteina ricombinante (coli non è in grado di

applicare delle modifiche quindi non è possibile cambiare la proteina per farle fare una

determinata azione)

• Spesso le proteine sono prodotte denaturate (necessitano di re-folding). Gli intermedi del

ripiegamento espongono delle regioni idrofobiche particolari durante il ripiegamento;

normalmente invece sono mascherate. In questo modo le regioni idrofobiche attraggono altre

sequenze idrofobiche. Si formano quindi dei corpi di intrusione all'interno del batterio che

somigliano a spore; ma, non essendo Coli sporigeno, sono solamente degli agglomerati di

intermedi di folding. Esistono delle procedure che permettono di recuperare i corpi d'inclusione,

denaturarli e poi facilitare la rinaturazione; essendo fatta in vitro però non sempre funziona.

• Problemi nell’espressione di proteine multimeriche e con ponti S-S (la struttura della proteina

non è quella presente negli eucarioti, cambia la struttura terziaria a causa di questi ponti S-S)

• Proteolisi

Trascrizione:

Nei procarioti inizia a la fine del promotore (posizione +1) e termina alla fine del terminatore che

può dipendere o meno da Rho. Raramente l'mRNA è monocistronico quindi vengono trascritti più

geni, i geni sono infatti organizzati in operoni. Sono presenti 3 mRNA polimerasi, la 2 permette la

trascrizione di mRNA delle proteine.

Negli eucarioti è presente una differenza spaziale tra nucleo e citoplasma; i geni sono

monocistronici e vengono sottoposti a capping, poliadenilazione e splicing (anche alternativo: lo

stesso mRNA può dare origine a mRNA maturi differenti a seconda degli esoni uniti e del loro

ordine). Il promotore viene riconosciuto dalla RNA polimerasi II; sono inoltre presenti delle

modificazioni post-trascrizionali dell'mRNA.

Traduzione:

Procarioti: sito di legame iniziale con ATG iniziale (fMET: formilmetionina) e sequenza di Shine-

Delgarno. 74

Eucarioti: l'mRNA viene riconosciuto tramite il capping; poi il ribosoma migra fino al primo AUG.

Oppure c'è la sequenza di Kozak. La traduzione si conclude con il codone di stop (non confondere

con il segnale di terminazione che è nella trascrizione).

Negli Eucarioti, la sequenza di Kozak è una corta sequenza interna dell'mRNA (ACCAUGG)

riconosciuta dal complesso di pre-inizio della traduzione (comprendente la subunità ribosomale

minore 40S) mentre questo scansiona l'mRNA a partire dal cappuccio al 5'; solo dopo che è

avvenuto il legame fra la subunità ribosomale 40S e tale sequenza, la subunità ribosomiale

maggiore può completare il complesso d'inizio consentendo l'avvio della sintesi proteica all'interno

della sequenza di Kozak è contenuto il codone d'inizio AUG, codificante per la metionina. La

sequenza di Kozak è l'equivalente eucariotico della sequenza di Shine-Dalgarno, che nei procarioti

identifica il sito di aggancio del ribosoma all'mRNA durante l'avvio della sintesi proteica; tuttavia,

nei Procarioti non si verifica nessuna scansione a partire dal 5', bensì un appaiamento fra basi

complemetari dell'mRNA e dell'rRNA 16S della subunità ribosomale minore 30S.

Ottimizzazione della trascrizione

Il livello di espressione di un gene dipende in larga misura dalla forza del promotore che lo

controlla determinando la frequenza con la quale la RNA polimerasi inizia la trascrizione. Si

possono usare promotori costitutivi o regolabili Un promotore procariotico tipico è costituito da

circa 60 bp contenenti due sequenze consenso che precedono l’inizio della trascrizione.

Più queste sequenze si avvicinano al consenso maggiore è la forza del promotore

-35 (ttcaga) e -10 (tataat)

Si tende sempre a scegliere un promotore inducibile per varie ragioni.

In primo luogo, quantità eccessive di proteina possono intossicare il batterio, uccidendolo prima

che la colonia abbia raggiunto plateau. In secondo luogo, più la quantità di proteina è elevata, più è

probabile che il batterio attivi sistemi di difesa proteolitici.

Con l'uso di un promotore regolabile il sistema è bloccato fino a quando non si è raggiunto un

punto adeguato della crescita batterica; a quel punto l'operatore aggiunge un induttore che attivi il

promotore ottenendo un'alta efficienza di produzione.

Alcune proteine possono essere tossiche o, comunque, interferire con la crescita dell’ospite di

espressione. In alcuni casi fino al 50% delle proteine totali sono costituite dalla proteina

ricombinante, a discapito delle proteine che assicurano il normale metabolismo di E. coli. La

possibilità di limitare l’espressione della proteina alla sola fase di induzione permette il normale

sviluppo della cellula.

La possibilità, di indurre sperimentalmente l’espressione della proteina rappresenta un primo

strumento di verifica dei livelli di espressione; comparando un estratto proteico indotto con uno

non indotto si riesce facilmente ad evidenziare la presenza della proteina eterologa (di cui

conosciamo il peso molecolare).

Invece di usare promotori costitutivi, quindi attive sempre, si usa una inducibile così che si possa

attivare la produzione di proteina ricombinante solo quando il numero di batteri è tale per cui,

anche se vengono intossicati e muoiono, si ottengono elevate quantità di proteina.

SI fa una liquota di batteri prima e dopo l'induzione e poi si fa un'elettroforesi per le proteine

cercando di trovare una banda differente così da riconoscere la proteina ricombinante.

Esempi di promotori forti inducibili o reprimibili

Tra i più comuni usati in E.Coli:

-Promotore lac → senza lattosio, o un galattoside analogo come IPTG, il promotore è

inattivo. Viene mantenuto tale finché non si raggiunge la fase stazionaria di crescita: a quel punto

75

si aggiunge l'induttore alla coltura perché anche se i batteri si intossicano, ormai il picco di crescita

è stato raggiunto. Se si sostituisce LacZ (β-galattosidasi) con il gene di interesse, inizialmente non si

produce nulla, quando si aggiunge IPTG si ha il distacco del promotore e si incomincia a produrre la

proteina ricombinante desiderata data dal gene sostituito.

-Promotore trp → Funziona al contrario di quello precedente: quando manca il triptofano, il

promotore si attiva. Basta spostare la coltura in un terreno provo dell'amminoacido perché si attivi

l'espressione della proteina con questo promotore. Si mette, quindi, il batterio in un terreno ricco

di trp così che non si attivi la produzione di gene e il repressore rimanga attaccato; per indurre la

produzione si centrifugano i batteri e li si inseriscono in un terreno minimo. In questo modo si ha il

distacco del promotore per la produzione di trip così il gene sostituito al gene trp viene tradotto e

trascritto dando la proteina ricombinante.

Nel caso del promotore di lambda si ha il vantaggio che sia termolabile quindi se lo si pone in

abiente sotto i 30° non si ha trascrizione, se si aumenta la temperatura si ha il distacco del

repressore e l'inizio della trascrizione.

Sono stati poi realizzati promotori misti come:

-Promotore tac → dato dalla fusione del promotore lac e trp, consente di avere un

meccanismo di controllo doppio.

-Promotore P e P di lambda → in questo caso cl è il promotore che blocca entrambi i

R L

promotori forti; poiché cl è termolabile basta semplicemente alzare la T del terreno perché quello

sia denaturato e il sistema attivato.

-Promotore T7 → è il promotore più diffuso. L'espressione avviene tramite RNA polimerasi

del fago T7 il cui gene è inserito nel vettore. Il gene target si trova a valle del promotore T7 che è

unico e viene riconosciuto con alta efficienza dalla sua RNA polimerasi. I livelli di espressione con

questo metodo sono elevatissimi; senza un qualche tipo di controllo, il promotore T7 sarebbe

costitutivo, per questo motivo si è deciso di controllare l'espressione dell'RNA polimerasi

bloccando il sistema e rendendo il gene inducibile. Per questo il gene RNA polimerasi è messo a

valle del promotore lac, non attivo se non presente l'induttore. Viene inoltre inserito un plasmide

contenente il gene per il lisozima che interagisce e inattiva la RNA polimerasi fagica, erroneamente

espressa.

Aggiungendo IPTG si stacca il repressore dai primi due blocchi. In questo modo si ha la produzione

della polimerasi che può andare a produrre il gene La (con gene di espressione). A questo punto il

lisozima, che viene sempre prodotto, è troppo poco per bloccare trascrizione.

Questi sistemi sono detti Leacky “gocciolare, perdita” perché a volte riescono comunque a

superare il bloccoe vengono quindi persi dei piccoli frammenti di mRNA.

Ottimizzazione della traduzione

Perchè avvenga la traduzione, l'mRNA trascritto deve essere costruito in modo compatibile al

sistema di espressione utilizzato.

-Il sito di legame al ribosoma

L’inizio della traduzione in E. coli, richiede la presenza, sulla porzione non tradotta al 5’ del mRNA,

di una regione di legame al ribosoma (RBS). Nei batteri è costituita da una sequenza, chiamata

Shine-Dalgarno (SD), complementare al 3’ del rRNA 16S presente nella subunità ribosomale piccola

30S e dall’AUG iniziale. 5’ ---UAAGGAGG-NNNNNNNN-AUG--- 3’

La spaziatura ottimale tra SD e AUG è di 8 bp 76

E’ importante che la sequenza nucleotidica tra la SD e il codone d’inizio non sia disturbata da

strutture secondarie (es. forcine ) che possono interferire drasticamente con il legame al ribosoma

e la conseguente traduzione.

-Ottimizzazione al codon usage dell’ospite

Poiché organismi diversi possono utilizzare preferenzialmente codoni sinonimi per specificare uno

stesso amminoacido e poiché è nota la percentuale di utilizzazione media dei codoni sinonimi in

molti organismi è possibile aumentare i livelli di espressione modificando i codoni del gene di

interesse senza alterarne il prodotto di espressione.

-Utilizzo di plasmidi contenenti codoni rari

In alternativa, insieme al plasmide di espressione per il gene d’interesse, si può trasformare il

ceppo batterico con plasmidi (ad es RIL per Arg, Ile, Leu) che codificano per tRNA corrispondenti a

codoni rari in E. coli rispetto agli eucarioti.

Quando trasferiamo un gene umano riconosciuta da molti tRNA, in Coli non è detto che ci siano

sufficienti tRNA per tradurre la proteina perchè ci sono dei codoni comuni nell'uomo che in coli

sono rari. Se la trascrizione avviene bene non è detto la che traduzione vada a buon fine.

Due alternative:

– si crea in sintesi un gene di lab che possa essere riconosciuto dai tRNA di coli in base al suo

Codon usage di coli.

– Si inseriscono in coli i tRNA necessari, devono essere trattati con un antibiotico particolare.

Vettori di espressione

Un vettore d’espressione è essenzialmente un plasmide contenente tutti quei segnali capaci di

ottimizzare la corretta trascrizione e traduzione dei geni eterologhi nell’ospite in cui avviene

l’espressione. Per aumentare le rese si cerca di ottimizzare la stabilità dei prodotti di espressione,

sia a livello trascrizionale che traduzionale. (Sequenza di shine-delgarno, promotore batterico,

terminatore batterico + origine di replicazione del batterio e gene per l aresistenza all'antibiotico).

Un vettore d’espressione può essere usato per produrre una proteina nativa o una proteina

chimerica (di fusione).

L'esogeno è per convenienza cDNA per eliminare il problema della maturazione dell'mRNA.

Tramite PCR viene deleta solitamente sia la regione 3'-UTR sia quella 5'-UTR e vengono inseriti siti

di restrizione per facilitare il clonaggio.

Possono essere passati anche solo gli esoni su PCR, ma normalmente, nell'espressione della

proteina, si cerca di estrarre la sequenza codificante per la proteina d'interesse (da ATG a codone di

stop). Manca la sequenza di SD nel vettore così che ATG si posizioni alla distanza ottimale: va

inserita nel plasmide nel batterio.

Un vettore d'espressione può essere usato per produrre una proteina nativa o una proteina

chimerica (di fusione).

Espressione di proteine native (originaria, dalla sua Met al suo codone di stop)

Quando si vuole studiare l’attività biologica di una proteina si preferisce utilizzare un vettore

d’espressione nativo. La maggior parte dei vettori d’espressione per proteine native hanno un sito

di restrizione unico per NcoI o NdeI posizionato a valle del promotore e della sequenza di SD, che

contengono il codone per la Met iniziale. Il vettore in questo caso deve essere vuoto.

Alternativamente si fonde la proteina codificante con il vettore di espressione (che non è vuoto,

ma c'è già parte del gene che origina una proteina batterica). Cloniamo la sequenza codificante

77


PAGINE

79

PESO

2.67 MB

PUBBLICATO

4 mesi fa


DETTAGLI
Corso di laurea: Corso di laurea in biologia
SSD:
Università: Parma - Unipr
A.A.: 2017-2018

I contenuti di questa pagina costituiscono rielaborazioni personali del Publisher ari_kokoro di informazioni apprese con la frequenza delle lezioni di Tecnologie del DNA ricombinante e studio autonomo di eventuali libri di riferimento in preparazione dell'esame finale o della tesi. Non devono intendersi come materiale ufficiale dell'università Parma - Unipr o del prof Bolchi Angelo.

Acquista con carta o conto PayPal

Scarica il file tutte le volte che vuoi

Paga con un conto PayPal per usufruire della garanzia Soddisfatto o rimborsato

Recensioni
Ti è piaciuto questo appunto? Valutalo!

Altri appunti di Corso di laurea in biologia

Respirazione, fotorespirazione e fotosintesi, Biologia
Appunto
Appunti di fisiologia Generale I completi
Appunto
Microbiologia con fondamenti di immunologia
Appunto
Biologia molecolare
Appunto