Che materia stai cercando?

Basi biologiche e genetica umana - trasmissione dei caratteri

Appunti di Basi biologiche e genetica umana sui seguenti argomenti: la trasmissione dei caratteri da cromosomi diversi (attraverso la meiosi), i possibili gameti che possono generarsi ( tenendo conto del gruppo sanguigno ), lo studio del comportamento degli alleli e del crossing over .

Esame di Basi biologiche e genetica umana docente Prof. A. Piazza

Anteprima

ESTRATTO DOCUMENTO

D,d d,d

Se,se se,se non

secretore

D,d

D,d

d,d Se,se

Se,se

d,d

se,se d,d

se,se se,se

D,d d,d

Se,se se,se non

secretore

D,d

D,d

d,d Se,se

Se,se

d,d

se,se d,d

se,se se,se RICOMBINANTE !

Linkage: Crossing Over Causes New

Combinations of Genes

Linkage Family

COMBINAZIONI PARENTALI COMBINAZIONI GAMETICHE FREQUENZA

A B

meiosi

A B } 50%

A B

A B

a b a b } 50%

a b a b

A B (1-

A B A b

A B 

}

a B

a b 

a b

a b 

(1-

Frequenza di ricombinazione (θ) =

Numero di gameti ricombinanti

---------------------------------------

totale dei gameti

D,d d,d

Se,se se,se non

secretore

D,d

D,d

d,d Se,se

Se,se

d,d

se,se d,d

se,se se,se RICOMBINANTE !

-Determinare la frequenza di ricombinazione Gameti ricombinanti

Recombination during meiosis (Fig 8-18)

un doppio crossing-over

ripristina la situazione

originaria per i due loci

considerati. ?

Qual’e’ il valore massimo di

 è al massimo 0,5

Ogni evento di crossing over coinvolge soltanto

due dei quattro cromatidi alla profase della I meiosi

B B

A A

b 50% R 50% NR

b

Single crossing over A A

a a

B B

a a

b b

B

B A

A B 100% NR

A

B

A

2-strands a b

a b a

a b

b B

B A

A 50% R 50% NR

b

A

b

Double A

3-strands B

a

B

a

crossing over a

a b

b b

A

b

A b

A

4-strands b

A 100% R

a B

a B a

a B

B

Due loci con frequenza di ricombinazione

0,5 sono indipendenti D, d

1) D d A1,A2

A1 A2 1) NR NR NR NR NR R

2) d D 2) R R R R R NR

A1 A2 D, d

1) D d A1,A2

A1 A2 1) NR NR NR NR NR R

2) d D 2) R R R R R NR

A1 A2

NR NR NR NR NR R

ANALISI DI TRE GENERAZIONI

LOCI: NAIL-PATELLA

ABO

Che probabilità hanno i tre bambini di sviluppare la malattia?

D d LOCI: NAIL-PATELLA

ABO

D,d

0 B B, 0 D d

D,d

0, 0 0 0

FAMIGLIA NON INFORMATIVA

Polimorfismi usati per la diagnosi molecolare

Intergenico Intragenico

La sua utilità dipende E’ il più utile per una

dalla distanza dal gene diagnosi molecolare

Analisi di linkage con marcatori

concatenati

• Microsatelliti

• RFLP (restriction fragment length

polymorphism)

POLIMORFISMI DA NUMERO VARIABILE DI

UNITA’ RIPETUTE IN TANDEM

VNTR - variable number of tandem repeats

MICROSATELLITI: L’ unità ripetuta è molto corta (1-4 bp)

si estendono fino a 1 Kb

MINISATELLITI: l’unità ripetuta ha dimensioni maggiori

si estendono da 2 a 20 Kb

Gli alleli di un microsatellite differiscono per il

numero di unità ripetute

ATGCCATCGCACACACACACACACAAGGCTCAT

ATGCCATCGCACACACACAGGCTCAT

ATGCCATCGCACACACACACAAGGCTCAT

ATGCCATCGCACACACACACACACACAAGGCTCAT

ATGCCATCGCACACACACACACACACACACAAGGCTCAT

ESSENDO MOLTO POLIMORFICI SONO

MARCATORI GENETICI MOLTO INFORMATIVI

ES: 3 ALLELI 6 GENOTIPI

Human Genetics by B.R. Korf, 2000

FAMIGLIA CON MEMBRI AFFETTI DA EMOFILIA A

(X-linked recessiva)

RISCHIO PER LE SORELLE DEI MALATI DI AVERE FIGLI EMOFILICI?


PAGINE

75

PESO

1.46 MB

PUBBLICATO

+1 anno fa


DETTAGLI
Corso di laurea: medicina e chirurgia
SSD:
Università: Torino - Unito
A.A.: 2013-2014

I contenuti di questa pagina costituiscono rielaborazioni personali del Publisher cecilialll di informazioni apprese con la frequenza delle lezioni di Basi biologiche e genetica umana e studio autonomo di eventuali libri di riferimento in preparazione dell'esame finale o della tesi. Non devono intendersi come materiale ufficiale dell'università Torino - Unito o del prof Piazza Alberto.

Acquista con carta o conto PayPal

Scarica il file tutte le volte che vuoi

Paga con un conto PayPal per usufruire della garanzia Soddisfatto o rimborsato

Recensioni
Ti è piaciuto questo appunto? Valutalo!

Altri appunti di Basi biologiche e genetica umana

Basi biologiche e genetica umana - patologie genetiche
Appunto
Basi biologiche e genetica umana - citoscheletro
Appunto
Basi biologiche e genetica umana - mutazioni geniche
Appunto
Basi biologiche e genetica umana - mitocondri
Appunto