Che materia stai cercando?

Anteprima

ESTRATTO DOCUMENTO

The amount of TE correlate positively with

genome size

Mb Genomic DNA

3000

2500 TE DNA

2000 Protein-coding

1500 DNA

1000

500

0

ium ld

st ora o t

s

t a ir

hila uit

si

as

o de

yea sh

c ze

e qu

m

od op

si

sp

e c use

gu an

sq

to i

i

Ri op

y as af

s

Ma

me

m id

ro

ing ma o m

Fu

n a

br o

Br os

as ab M

u

io Se Hu

Sli M

Ne

dd Ze

Ne

Dr

Pl ss Ar

Bu Fi Feschotte & Pritham 2006

The proportion of protein-coding genes decreases with genome size,

while the proportion of TEs increases with genome size

TEs

Protein-coding

genes

Gregory, Nat Rev Genet 2005

Comparative Genome Sizes

Genebuild last updated: October 2008

Known protein-coding genes: 21,343

Novel protein-coding genes: 73

Pseudogenes: 9,899

RNA-specifying genes: 5,732

Exons: 297,252

RNA transcripts: 62,877

SNPs: 15,040,632 14

N

-value paradox: Complexity

does not correlate with

protein-coding g

ene number

.

~25,000 genes ~25,000 genes ~60,000 genes

15

Genomic paradox:

Lack of correspondence between

measures of g

enome size and the

presumed amount of genetic

information “ needed ” by the

organism (its “

com p lexit y ”

). 16

The human genome is:

small

empty

unoriginal

repetitive 17

EVOLUZIONE

CROMOSOMICA?

At the genome level

1) Structural variations

Evoluzione

Homo Sapiens

Cromosomi minidi

- O

Compazione delle bande

I 6 cromosomi umani (Hu) più lunghi

sono comparabili con 7 cromosomi delle tre

specie delle grandi scimmie.

Example: the

Evolutionary Hypothesis

of Common Ancestry

Chromosome Numbers in

the great apes:

human (Homo) 46

chimpanzee (Pan) 48

gorilla (Gorilla) 48

orangutan (Pogo) 48

Testable prediction:

If these organisms share a common

ancestor, that ancestor had either

48 chromosomes (24 pairs) or

46 (23 pairs).

ANATOMIA DI UN

CROMOSOMA

Head I Cromosomi hanno i

Telomero telomeri alle estremità

Centromero

Tail I telomeri hanno sequenze

Telomero di DNA uniche …

ttagggttagggttagggttagggttagggttaggg…

||||||||||||||||||||||||||||||||||||

aatcccaatcccaatcccaatcccaatcccaatccc…

Ancestral

Chromosomes Fusion

Chromosome Numbers in Homo sapiens

the great apes

(Hominidae): Inactivated

centromere

human (Homo) 46

chimpanzee (Pan) 48 Telomere

sequences

gorilla (Gorilla) 48

orangutan (Pogo) 48 Centromere

Telomere

Testable prediction:

Common ancestor had 48 chromosomes (24 pairs) and

humans carry a fused chromosome; or ancestor had 23

pairs, and apes carry a split chromosome.

DOMANDA…

Perchè sono necessari

DUE piccoli cromosomi

di scimpanzè per fare il

cromosoma #2 umano?

Il cromosoma #2 umano potrebbe essersi formato

FUSIONE

dalla di DUE piccoli cromosomi di

scimpanzè (#12 e #13)?

Human

Chimp #2

#13

Chimp

#12 PREDIZIONE

Chimp

#13 Se una fusione è occorsa,

Human essa dovrebbe aver

#2 lasciato una traccia nel

DNA dell’unione testa-

testa dei due telomeri al

centro circa del

Chimp cromosoma #2

#12 Area di

Fusione? DNA

Head

Telomero Sequenze di DNA dei Telomeri:

ttagggttagggttaggg…

||||||||||||||||||

Centromero aatcccaatcccaatccc…

NOTARE:

Tandem Repeats nei Telomeri:

ttagggttagggttaggg…

||||||||||||||||||

Tail aatcccaatcccaatccc…

Telomero Repetuti 800-1600 volte

in ciascun Telomero

PREVISIONI

• Cosa cercare?

• tandem repeats nell’area di fusione

• Dove cercare?

• al centro del cromosoma #2 umano

• Come cercarli?

• nei database di DNA

• Se NON ci sono?

• la fusione potrebbe non essere avvenuta

RISULTATI

108061 agcacagacc tgggggtcac cgtaaaggtg gagcagcatt cccctaagca cagaggttgg

108121 ggccactgcc tggctttgtg acaactcggg gcgcatcaac ggtgaataaa atctttcccg

108181 gttgcagccg tgaataatca aggttagaga ccagttagag cggttcagtg cggaaaacgg

108241 gaaagaaaaa gcccctctga atcctgggca gcgagattct cccaaagcaa ggcgaggggc

108301 tgcattgcag ggtgagggtg agggttaggg tttgggttgg gtttggggtt ggggttgggg

108361 taggggtggg gttggggttg gggttggggt taggggtagg ggtaggggta ggggtagggt

108421 cagggtcagg gtcagggtta gggttttagg gttaggattt tagggttagg gtaagggtta

108481 agggttgggg ttggggttag ggttaggggt tagggttggg gttggggttg gggttggggt

108541 tggggttggg gttagggtta gctaaaccta accctaaccc ctaaccccaa ccccaacccc

108601 aaccctaccc ctacccctac ccctaacccc aacccccacc cttaaccctt aacccttacc

108661 ctaaccctaa cccaaaccct aaccctaccc taaccctaac ccaaccctaa ccctaaccct

108721 accctaaccc taacacccta aaaccgtgac cctgaccttg accctgaccc ttaaccctta

108781 accctaacca taaccctaaa ccctaaccct aaaccctaac cctaaaccct aaccctaaca

108841 ctaccctacc ctaaccccaa cccctaaccc ctaaccctaa ccctacccct aaccccaacc

108901 ccagccccaa cccttaccct aaccctaccc taacccttaa ccctaacccc taaccctaac

108961 ccctaaccct aaccctaccc caaccccaaa cccaacccta acccaaccct aacccctaac

109021 cctaacccct accctaaccc ctagccctag ccctagccct aaccctaacc ctcgccctaa

109081 ccctcaccct aaccctcacc ctcaccctaa cccaacgtct gtgctgagaa gaatgctgct

109141 ccgcctttaa ggtgcccccc aggtctgtgc tgaacagaac gcagctccgc cgtcgcagtg

109201 ccctcagccc gcccgcccgg gtctgacctg agaagaactc tgctccgcct tcgcaatagc

109261 cccgaagtct gtgcagagga gaacgcagct ccgccctcgc gatgctctcc ggctgtgtgc

109321 taaagagaac gcaactccgc cctcgcaaag gcggcgcgcc ggcggaggcg cggagaggcg

RISULTATI

108061 agcacagacc tgggggtcac cgtaaaggtg gagcagcatt cccctaagca cagaggttgg

108121 ggccactgcc tggctttgtg acaactcggg gcgcatcaac ggtgaataaa atctttcccg

108181 gttgcagccg tgaataatca aggttagaga ccagttagag cggttcagtg cggaaaacgg

108241 gaaagaaaaa gcccctctga atcctgggca gcgagattct cccaaagcaa ggcgaggggc

108301 tgcattgcag ggtgagggtg agggttaggg tttgggttgg gtttggggtt ggggttgggg HEAD

108361 taggggtggg gttggggttg gggttggggt taggggtagg ggtaggggta ggggtagggt 13

108421 cagggtcagg gtcagggtta gggttttagg gttaggattt tagggttagg gtaagggtta

108481 agggttgggg ttggggttag ggttaggggt tagggttggg gttggggttg gggttggggt

108541 tggggttggg gttagggtta gctaaaccta accctaaccc ctaaccccaa ccccaacccc

108601 aaccctaccc ctacccctac ccctaacccc aacccccacc cttaaccctt aacccttacc

108661 ctaaccctaa cccaaaccct aaccctaccc taaccctaac ccaaccctaa ccctaaccct

108721 accctaaccc taacacccta aaaccgtgac cctgaccttg accctgaccc ttaaccctta HEAD

108781 accctaacca taaccctaaa ccctaaccct aaaccctaac cctaaaccct aaccctaaca 12

108841 ctaccctacc ctaaccccaa cccctaaccc ctaaccctaa ccctacccct aaccccaacc

108901 ccagccccaa cccttaccct aaccctaccc taacccttaa ccctaacccc taaccctaac

108961 ccctaaccct aaccctaccc caaccccaaa cccaacccta acccaaccct aacccctaac

109021 cctaacccct accctaaccc ctagccctag ccctagccct aaccctaacc ctcgccctaa

109081 ccctcaccct aaccctcacc ctcaccctaa cccaacgtct gtgctgagaa gaatgctgct

109141 ccgcctttaa ggtgcccccc aggtctgtgc tgaacagaac gcagctccgc cgtcgcagtg

109201 ccctcagccc gcccgcccgg gtctgacctg agaagaactc tgctccgcct tcgcaatagc

109261 cccgaagtct gtgcagagga gaacgcagct ccgccctcgc gatgctctcc ggctgtgtgc

109321 taaagagaac gcaactccgc cctcgcaaag gcggcgcgcc ggcggaggcg cggagaggcg

PERCHE’ IL CAMBIO?

108361 taggggtggg gttggggttg gggttggggt taggggtagg ggtaggggta ggggtagggt HEAD

108421 cagggtcagg gtcagggtta gggttttagg gttaggattt tagggttagg gtaagggtta 13

108481 agggttgggg ttggggttag ggttaggggt tagggttggg gttggggttg gggttggggt

108541 tggggttggg gttagggtta gctaaaccta accctaaccc ctaaccccaa ccccaacccc HEAD

108601 aaccctaccc ctacccctac ccctaacccc aacccccacc cttaaccctt aacccttacc

108661 ctaaccctaa cccaaaccct aaccctaccc taaccctaac ccaaccctaa ccctaaccct 12

108721 accctaaccc taacacccta aaaccgtgac cctgaccttg accctgaccc ttaaccctta

(circa 37 ttaggg repeats nel Head 13; circa 88 ccctaa repeats nel Head 12)

Perché dei TANDEM REPEATS sono cambiati

ttaggg a ccctaa

da ?

Evoluzione

Homo Sapiens

Cromosomi minidi

- O

Inversione

Human Chromosome #2 shows the exact

point at which this fusion took place

“Chromosome 2 is unique to the human lineage of

evolution, having emerged as a result of head-to-

Homo sapiens head fusion of two acrocentric chromosomes that

remained separate in other primates. The precise

fusion site has been located in 2q13–2q14.1 (ref.

Inactivated 2; hg 16:114455823 – 114455838), where our

centromere analysis confirmed the presence of multiple

Telomere subtelomeric duplications to chromosomes 1, 5, 8,

sequences 9, 10, 12, 19, 21 and 22 (Fig. 3; Supplementary

Fig. 3a, region A). During the formation of human

chromosome 2, one of the two centromeres

became inactivated (2q21, which corresponds to

the centromere from chimp chromosome 13) and

the centromeric structure quickly deterioriated

Chr 2 (42).”

Hillier et al (2005) “Generation and Annotation of the DNA

sequences of human chromosomes 2 and 4,” Nature 434: 724 – 731.

Recent Duplication Architecture of the Human Genome

1

2

3

4

5

6

7

8 200 Mb 250 Mb

9

10

11 •Total: 5.26% (150.8 Mb)

12 •Inter: 2.36% (67.6 Mb)

13

14 •Intra: 3.87% (111.1 Mb)

15 •Non-random distribution

16 •5.3 fold bias to pericentromere

17

18 •389 regions > 100 kb nexi

19 “Heterochromatic” regions

20

21 Duplications

22

X 10 Mb

Y 50 Mb 150 Mb

100 Mb 2p22

10q26 11p15

2p11 (700 kb) 11q14 11q14 7q36

22q12

21q21 4p16.1

4p16.1

12q24

Xq28 4p16.3

12p11 4q24 7q36

Alpha Satellite ( build34, >90%, >1kb)

At the genome level

1) Structural variations

2) Segmental duplication

Inversions

• Human and chimp

chromosomes

• Inversion between

p14.1 and q14.1

• 9 total inversions

in human vs.

chimp

• Chromosome 3

very similar but

orangutans have a

large inversion

• May have

established

orangutans as a

new species

chromosomal fusion in the human lineage ?

Comparison of chimpanzee and human Y chromosomes.

JF Hughes et al. Nature 000, 1-4 (2010)

Segmental duplication (impact: 2.7 %)

Longer than 20 kilobases (-> 300 kb), greater than 94 %

sequence identity

- 33% of human duplicated segments are human specific

- 17 % of chimp duplication are chimp specific.

Half of the genes in the human specific duplicated regions

exhibit significant differences in gene expression relative

to chimp and are most often upregulated.

Cheng et al., Nature (2005)

About 300 region were identified where the human genome

showed significant increase in copy number when compared to

chimp.

‘Only’ 92 regions where the chimp genome showed an increase in

copy number compared to human (but with higher rate of

duplication) Cheng et al., Nature (2005)

Evoluzione

Homo Sapiens

Cromosomi minidi

- O

Cladogramma dei Primati

basato sui

riarrangiamenti

Cromosomici

La comparazione di sequenze di DNA indicano

il grado di correlazione evoluzionistica.

Il cariotipo tra le grandi scimmie

differisce per eventi di inversione.

Il cariotipo tra le grandi scimmie e altri

primati differisce soprattutto per

eventi di traslocazioni.

Tutti i cromosoma X nei mammiferi

hanno le stesse bande.

At the genome level

1) Structural variations

2) Segmental duplication

3) Interspersed/Transposable repeats

-The human genome is composed of ~ 45 % of interspersed elements

Including:

Long interspersed elements (LINEs); these encode a reverse transcriptase

Short interspersed elements (SINEs); these include Alu repeats

-The human genome contains about 1,000,000 Alu elements.

- Found only in primates .

Interspersed/Transposable element insertions (impact 3 %)

- endogenous mutagens which can alter genes, promote genomic

rearrangements…

- may help to drive the speciation of organisms

- Particular interest in recently mobilized transposons

- The transposons that inserted into human or chimp genome during the passed 6

mo years would be expected to be present in only one of the 2 genome.

~11’000 ‘recent’ transposons copies that are differentially present in

human/chimp:

73 % found in human and 27 % found in chimp

Interspersed/Transposable element insertions

Endogenous retrovirus Mills et al., Am. J. Hum. Genet., 78:671-679, 2006

At the sequence level

(coding sequence level)

At the gene level:

13’454 pair of orthologous genes

(507 Swiss-Prot, 1134 TrEMBL: 1641) (NCBI: 3111)

- 29 % are 100 % identical

- 5% with in-frame indel (mainly in repetitive region)

La comparazione di sequenze di DNA indicano

il grado di correlazione evoluzionistica.

La comparazione di sequenze di DNA indicano

il grado di correlazione evoluzionistica.

Percentuale di bande cromosomiche condivise tra

l’uomo e altre specie

Scimpanze 99+ %

Gorilla 99+ % Le bande sono

molto conservate

Orang-utan 99+ % tra l’uomo e le

African green monkey 95% grandi scimmie.

Gatto 35%

Topo 7%

Percentuale di differenza nella sequenza nucleotidica

Human-chimp 1.0%

Human-gorilla 2.3%

Human-orangutan 3.7%

Human-human 0.1%

Effetto “Bottleneck”ed evoluzione umana

• Si ritiene che la specie umana

abbia avuto inizio da una

popolazione sottoposta ad un

effetto “bottleneck” circa 100.000

anni fa. Si ritrova un numero

maggiore di variazioni genetiche

tra scimpanzè che vivono

nell’Africa Centrale a 50 km di

distanza che nell’intera specie

umana.

• Il grafico rappresenta le differenze

mutazionali nel DNA

mitocondriale tra vari membri

delle grandi scimmie e l’uomo.

The Chicken And The Egg

80 million years

Amniotic Egg

330 million years

Il Genoma dello Scimpanzè

98.5% in comune con il genoma umano.

- 35 milioni di sostituzioni di un singolo nucleotide

- 5 milioni di piccole inserzioni e delezioni

- riarrangiamenti locali

- 1 fusione cromosomica

• I cani hanno circa lo 0.15% variazione genomica ma una grande

di

differenza fenotipica

• Mus musculus e mus spretus hanno tra loro la stessa differenza che

esiste tra uome e scimpanzè, ma una piccola differenza fenotipica

Quantifying the sequence divergence:

Single nucleotide subtitutions: 1.23% (1, 78% for chromosome Y)

(0.8 % in protein coding region)

Indels: ~1.5 %

Transposable elements: 3 %

Recent duplication of DNA segments: 2.7 %

~ 35 mo nucleotides differences

~ 5 mo indels

Many chromosomal rearrangements

Human: 3.4 10 bp; Chimp: 3.6 10 bp

9 9

Animal Connection

• L’uomo condivide molti

fenotipi con gli animali

• Siamo molto simili alle

scimmie antropomorfe

– Le stesse 206 ossa

– Solo 3 dei circa 650 muscoli

sono differenti

– Il DNA è per il 98% lo stesso

– Stessi gruppi sanguigni

Gorilla Albino


PAGINE

112

PESO

23.95 MB

AUTORE

kalamaj

PUBBLICATO

+1 anno fa


DESCRIZIONE APPUNTO

Appunti di Genetica umana sui presenti argomenti: evoluzione della specie, Banca del genoma umano,complessità del genoma nei vertebrati, caratteristiche del genoma umano, anatomia del cromosoma, grado di comparazione evoluzionistica, genoma dello scimpanzè, proteina FoxP2, miosina, esempi molecolari.


DETTAGLI
Corso di laurea: Corso di laurea magistrale in medicina e chirurgia (a ciclo unico - 6 anni)
SSD:
Università: Foggia - Unifg
A.A.: 2012-2013

I contenuti di questa pagina costituiscono rielaborazioni personali del Publisher kalamaj di informazioni apprese con la frequenza delle lezioni di Genetica Umana e studio autonomo di eventuali libri di riferimento in preparazione dell'esame finale o della tesi. Non devono intendersi come materiale ufficiale dell'università Foggia - Unifg o del prof Margaglione Maurizio.

Acquista con carta o conto PayPal

Scarica il file tutte le volte che vuoi

Paga con un conto PayPal per usufruire della garanzia Soddisfatto o rimborsato

Recensioni
Ti è piaciuto questo appunto? Valutalo!

Altri appunti di Genetica umana

Genetica Umana - Appunti
Appunto
Genetica umana - mutazioni monogeniche - Appunti
Appunto
Genetica umana - genetica di popolazione - Appunti
Appunto
Genetica umana - variabilità del fenotipo - Appunti
Appunto