Che materia stai cercando?

Genetica medica - genetica, gene e genoma

Appunti di Genetica medica con particolare interesse per i seguenti argomenti: genetica, gene e genoma, proprietà comuni degli esseri viventi, diametro delle cellule eucariote, carattere ereditario familiare, congenito e genetico, le branche della genetica: biologia e medicina.

Esame di Genetica medica docente Prof. D. Turchetti

Anteprima

ESTRATTO DOCUMENTO

Query: GENE UMANO PER L’INSULINA

Query: 1 gctgcatcagaagaggccatcaagcacatcactgtccttctgccatggccctgtggatgc

|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||

Sbjct: 16 gctgcatcagaagaggccatcaagcagatcactgtccttctgccatggccctgtggatgc

Query: GENE UMANO PER L’INSULINA

Query: 144 cacctggtggaagctctctacctagtgtgcggggaacgaggcttcttctacacacccaag

||||||||||| ||||||||||| ||||| ||||| || ||||||||||||||||||| |

Sbjct: 240 cacctggtggaggctctctacctggtgtgtggggagcgtggcttcttctacacacccatg

“Noi riteniamo che un gene, o forse

l’intera fibra cromosomica, sia

un solido aperiodico”

“Ci siamo spesso chiesti come mai

questa insignificante particella di

materia, il nucleo dell’uovo

fecondato, possa contenere tutto

un elaborato codice che riguarda

tutto il futuro sviluppo

dell’organismo”

Gilbert, “Developmental Biology”

Sinauer, 2000

• “La fecondazione: l’inizio di un nuovo

organismo”

• “La fecondazione è il processo per cui due

cellule germinali si fondono insieme per

creare un nuovo individuo con potenziali

genetici derivati da entrambi i genitori”

Alberts et al. “Molecular biology of the cell”

Garland, 2002

Fecondazione

• “Una volta rilasciati, la cellula uovo e lo

spermatozoo sono destinati a morire in pochi

minuti o ore, a meno che si trovino l’un l’altro e si

fondano nel processo di fecondazione” .

• “Mediante la fecondazione, la cellula uovo e lo

spermatozoo sono conservati: l’uovo viene

attivato per iniziare il suo programma di sviluppo,

e i nuclei aploidi dei due gameti concorrono a

formare il genoma di un nuovo organismo

diploide”

Gilbert, “Developmental Biology”

Sinauer, 2000

“ La classificazione tradizionale cataloga gli animali

secondo la loro struttura da adulti. ...

Quando noi consideriamo un cane, per

esempio, noi di solito ci raffiguriamo un adulto.

Ma il cane è un “cane” sin dal momento della

fecondazione di una cellula uovo di cane da parte

di uno spermatozoo di cane. Rimane un cane

anche quando è un bracco vecchio e morente.

Quindi, il cane è in realtà l’intero ciclo vitale

dell’individuo, dalla fecondazione alla morte.”

X Y

SPERMIOGENESI: DA SPERMATIDI A SPERMATOZOI

(24 GIORNI) ACROSOMA

TESTA NUCLEO

COLLO PARTE INTERMEDIA

MITOCONDRIO

CODA FLAGELLO

10 m

REAZIONI DELL’UOVO FERTILIZZATO

BLOCCO DELLA

POLISPERMIA ATTIVAZIONE

UOVO

> METABOLISMO

PERDITA DUPLIC. CENTRIOLO

RECETTORI DUPLIC. CENTROSOMA

ZONA PELLUCIDA FUSO MITOTICO

INIZIO 1° MITOSI

2 cell dopo 24-30h

GRANULI CORTICALI

ESCONO: UNIONE

MEMBRANA DI CROMOSOMI

FECONDAZIONE

COMPIMENTO PRONUCLEI

MEIOSI II DUPLICAZIONE DNA

Ambiente

Geni 4 cause formali di

differenza genetica

tra gemelli monozigoti

• Mutazione somatica

• DNA mitocondriale

• Loci per Ig e TCR

• Cromosoma X (femmine)

Louis Pasteur “lo Zingarelli 2005”,

Vocabolario di Italiano

Embrione:

dal gr. émbryon, “che cresce dentro”; bry’ein:

germogliare, fiorire;

(biol.=biologia)

Individuo animale nei suoi primi stadi di

sviluppo dopo la fecondazione della cellula

uovo.


PAGINE

62

PESO

1.50 MB

AUTORE

Moses

PUBBLICATO

+1 anno fa


DETTAGLI
Corso di laurea: Corso di laurea in infermieristica (BOLOGNA, RAVENNA e RIMINI)
SSD:
Università: Bologna - Unibo
A.A.: 2008-2009

I contenuti di questa pagina costituiscono rielaborazioni personali del Publisher Moses di informazioni apprese con la frequenza delle lezioni di Genetica medica e studio autonomo di eventuali libri di riferimento in preparazione dell'esame finale o della tesi. Non devono intendersi come materiale ufficiale dell'università Bologna - Unibo o del prof Turchetti Daniela.

Acquista con carta o conto PayPal

Scarica il file tutte le volte che vuoi

Paga con un conto PayPal per usufruire della garanzia Soddisfatto o rimborsato

Recensioni
Ti è piaciuto questo appunto? Valutalo!

Altri appunti di Genetica medica

Genetica medica -  nozioni generali
Appunto
Genetica medica - lezione
Appunto
Genetica medica - problemi di interpretazione degli alberi genealogici
Appunto
Genetica medica - il cariotipo umano
Appunto