Che materia stai cercando?

Anteprima

ESTRATTO DOCUMENTO

Experimental procedure

In a sterile 0,5 ml microfuge tube, mix in the following order

amplification buffer

MgCl 2

primer up

primer down

template DNA (10-100ng)

dNTP

polymerase enzime

H2O to a final volume !

2-3µg of DNA

Polymerase Chain Reaction

Advantages Disadvantages

Powerful technique Contaminations

in vitro

Carried out (in lab) Possible aspecifity

Extremely simple technique

?

OLIGO UP >YLR175W Chr 12

ATGTCAAAGGAGGATTTCGTTATTAAGCCTGAAGCTGCAGGTGCTTCCACTGACACTAGT

GAATGGCCATTACTTTTGAAGAATTTTGATAAGTTATTAGTCAGAAGTGGTCATTATACC

OLIGO DOWN CCTATCCCAGCTGGTAGTTCACCACTAAAGAGAGACCTGAAATCATATATCAGCTCTGGT

GTCATTAATCTACATAAACCTTCCAACCCATCATCGCACGAAGTTGTAGCTTGGATCAAA

GTCGAAACTGAGAAGGAAGAAGTGAAAGAGGATGACAGCAAAAAGGAAAAGAAAGAGAAG

AAGGACAAGAAGGAAAAGAAGGAAAAGAAAGAAAAGAAGGACAAGAAGGAAAAGAAAGAG

AAAAAGGAGAAGAAAAGAAAGTCTGAAGACGGTGATTCTGAGGAAAAGAAATCTAAGAAA

TCTAAGAAATGA

XbaI 5’…TCTAGA…3’

3’...AGATCT…5’

EcoRI 5’…GAATTC…3’

3’...CTTAAG…5’

PCR applications

PCR: APPLICAZIONI PCR mutagenesis: the “inverse” PCR

amplification ligase

PCR: APPLICAZIONI Screening gene libraries

screening

Tradizionalmente questo veniva fatto tramite ibridazione. Il vantaggio

della PCR e’ la rapidita’: 3-4 ore anziche’ giorni. In questo modo si ottiene una

indicazione di dimensioni, anziche’ di sequenza. Possono pero’ essere utilizzati anche

primers specifici per il DNA inserito

PCR-based

PCR: APPLICAZIONI cycle sequencing

primers ELONGATION

72°C, ~1min

strands terminated

by

dideoxynucleotide

RENATURATION

~55°C, ! 1min after ~25 cycles

DENATURATION DNA sequence

95°C, ! 1min analysis

APPLICAZIONI

PCR cloning : primers may have additional sequences at the 5’ end

BamHI EcoRI final

product

APPLICAZIONI

One-step PCR : construction of conditionally expressed and

epitope tagged yeast proteins

PCR: APPLICAZIONI RT-PCR : Reverse Transcription PCR

permette di rivelare mRNA molto rari!!

5’ AAAAA 3’

mRNA 3’ TTTTT 5’

Primer 1 reverse transcriptase

(RNA-dependent DNA polymerase)

AAAAA 3’

mRNA 5’ 5’

TTTTT

cDNA 3’ Rimozione RNA

(RNase A) TTTTT 5´

cDNA 3’ + PCR primers

3’

Primer 2 5’ TTTTT

3’ 5’ Primer 3

+ Taq polimerasi. Run PCR

Experimental procedure

-purificare l’RNA

-aggiungere i primer

-mescolare l’RNA con la trascrittasi

inversa per effettuare la sintesi del

primo filamento di cDNA

-aggiungere la DNA polimerasi

termostabile per effettuare la

sintesi del secondo filamento di

cDNA e per amplificarlo con i cicli

della PCR

RT-PCR: APPLICAZIONI latenti attivi

Dimostrazione della presenza di malattie infettive: virus o

Con la PCR e’ stato possibile dimostrare la presenza di particelle virali attive in piccolissime quantita’, il che

ha permesso di approntare nuove tecniche diagnostiche. Esempi sono i virus HCV, HBV, HIV, i batteri

Chlamydia, Mycobacterium, Neisseria, Salmonella.

RT-PCR: APPLICAZIONI Caratterizzazione delle isoforme di splicing

3’

5’ Isoforma A

XIV

XIII

5’ SPLICE SITES 3’ SPLICE SITE 3’

5’ XIV

XIII

pre-mRNA 5’ 3’ Isoforma B

XIV

XIII Isoforma A

219bp

129bp Isoforma B

Chromatin Immuno Precipitation (ChIP)

has given us significant insight into how genes are regulated

natural

in their context

?

ChIP

What is where

A metod used to determine and

when a particular protein is located near

specific DNA sequences

ChIP has been used for mapping various factors involved in

DNA-related processes (replication, modification, transcription)…

DNA

other

…and for mapping factors associated with transcription

not directly

complexes but associated with DNA (mRNA

capping enzime and other mRNA processing factors). Such crosslinking is

strongly indicative of a cotranscriptional mRNA processing

RNA DNA

The Chromatin

Chromatin from most sources is a suitable substrate for ChIP

yeast tissues

Hela cells

Two types of ChIP can be recognised:

N-ChIP native

: chromatin is used as substrate

-antigens cannot be oscured or modified by the chemical cross-linking

-only proteins tightly associated with chromatin can be immunoprecipitated

X-ChIP cross-linked

: chromatin is used as substrate

-more widely used than N-ChIP

The principle of ChIP is simple:

the selective enrichment of a

chromatin fraction containing a

specific protein

XChIP consist of the following steps

in vivo

1. Crosslinking of cells with formaldehyde

2. Cell Lysis and Collection of whole cell extract

3. Fragmentation of the chromatin by sonication

4. Immunoprecipitation of the resulting chromatin fragments

5. Reversal of cross-link by heat treatment and proteinase

digestion and Extraction of DNA

6. PCR analysis of the immunoprecipitated fraction to

determine the level of a target DNA sequence


PAGINE

44

PESO

4.28 MB

AUTORE

Atreyu

PUBBLICATO

+1 anno fa


DESCRIZIONE DISPENSA

Dispensa di Biologia Molecolare II della Prof.ssa Irene Bozzoni, all'interno del quale sono affrontati i seguenti argomenti: la Reazione a catena della polimerasi (Polymerase Chain Reaction - PCR), analisi delle procedure sperimentali, analisi dei vantaggi e svantaggi; la RT-PCR, Reverse Transcription PCR; l'Immunoprecipitazione della cromatina (Chromatin Immuno Precipitation - ChIP).


DETTAGLI
Corso di laurea: Corso di laurea in scienze biologiche
SSD:
A.A.: 2008-2009

I contenuti di questa pagina costituiscono rielaborazioni personali del Publisher Atreyu di informazioni apprese con la frequenza delle lezioni di Biologia Molecolare II e studio autonomo di eventuali libri di riferimento in preparazione dell'esame finale o della tesi. Non devono intendersi come materiale ufficiale dell'università La Sapienza - Uniroma1 o del prof Bozzoni Irene.

Acquista con carta o conto PayPal

Scarica il file tutte le volte che vuoi

Paga con un conto PayPal per usufruire della garanzia Soddisfatto o rimborsato

Recensioni
Ti è piaciuto questo appunto? Valutalo!

Altri appunti di Biologia molecolare ii

Analisi di proteine - Elettroforesi e Western Blot
Dispensa
Produzione dell'estremità 3 degli RNA degli istoni
Dispensa
Elettroforesi di acidi nucleici
Dispensa
Southern blot, Northern Blot ed Elettroblot
Dispensa